View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0095_high_49 (Length: 262)

Name: NF0095_high_49
Description: NF0095
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF0095_high_49
[»] chr3 (2 HSPs)
chr3 (1-233)||(49619113-49619345)
chr3 (177-222)||(49614144-49614189)
[»] chr6 (8 HSPs)
chr6 (91-208)||(2930024-2930144)
chr6 (139-210)||(2965243-2965317)
chr6 (95-210)||(2974718-2974830)
chr6 (91-210)||(2952667-2952785)
chr6 (91-173)||(2935353-2935436)
chr6 (140-210)||(2983577-2983650)
chr6 (140-210)||(2996667-2996740)
chr6 (91-210)||(3003010-3003131)
[»] scaffold0024 (1 HSPs)
scaffold0024 (97-184)||(43599-43689)

Alignment Details
Target: chr3 (Bit Score: 225; Significance: 1e-124; HSPs: 2)
Name: chr3

Target: chr3; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 1 - 233
Target Start/End: Complemental strand, 49619345 - 49619113
1 tttgattggtttatcttttttcacttaccaccatgtaaggtcattgatcccctggttaattattgggggtttcataaatatttcacgcaaaacacctatt 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||    
49619345 tttgattggtttatcttttttcacttaccaccatgtaaggtcattgatcccctggttaattattgggggtttcataaatctttcacgcaaaacacctatt 49619246  T
101 tatataatattagaatttcaatctaatacaataaacatgataatgaaaccattggaacaaacaacgtaaattggtgataataatgtcaataatcatgaac 200  Q
    ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
49619245 tatataatattagaatttcaatctaatacaacaaacatgataatgaaaccattggaacaaacaacgtaaattggtgataataatgtcaataatcatgaac 49619146  T
201 tcaacaatgattgaacttactactagtacttac 233  Q
49619145 tcaacaatgattgaacttactactagtacttac 49619113  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 177 - 222
Target Start/End: Complemental strand, 49614189 - 49614144
177 ataataatgtcaataatcatgaactcaacaatgattgaacttacta 222  Q
    ||||||||  ||||||| ||||| ||||||||||||||||||||||    
49614189 ataataatcacaataattatgaattcaacaatgattgaacttacta 49614144  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 51; Significance: 3e-20; HSPs: 8)
Name: chr6

Target: chr6; HSP #1
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 91 - 208
Target Start/End: Complemental strand, 2930144 - 2930024
91 aacacctatttatataatattagaatttcaatctaatacaataaacatgataatgaaaccattggaacaaacaacgtaaattggtgataataa---tgtc 187  Q
    ||||||||||||||| | |||| |||||  ||||||||||| | |||  ||||||||||||||| ||||||||||||| ||||||||||||||   |  |    
2930144 aacacctatttatatgaaattacaattttgatctaatacaacacacaaaataatgaaaccattgaaacaaacaacgtacattggtgataataagaataac 2930045  T
188 aataatcatgaactcaacaat 208  Q
    |||||| ||||||||||||||    
2930044 aataattatgaactcaacaat 2930024  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 139 - 210
Target Start/End: Complemental strand, 2965317 - 2965243
139 gataatgaaaccattggaacaaacaacgtaaattggtgataa---taatgtcaataatcatgaactcaacaatga 210  Q
    |||||||||||||||| ||||||||||||| |||||||||||   ||||  ||||||| ||||||||||||||||    
2965317 gataatgaaaccattgaaacaaacaacgtacattggtgataatactaatagcaataattatgaactcaacaatga 2965243  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 95 - 210
Target Start/End: Complemental strand, 2974830 - 2974718
95 cctatttatataatattagaatttcaatctaatacaata-aacatgataatgaaaccattggaacaaacaacgtaaattggtgataataatgtcaataat 193  Q
    ||||||||||| | |||| |||||||||||||| ||| | || | ||||||||||| |||| ||||||||||||| ||||   |||||||||  ||||||    
2974830 cctatttatatgaaattataatttcaatctaatgcaacacaaaaagataatgaaac-attgaaacaaacaacgtacattg---ataataatgaaaataat 2974735  T
194 catgaactcaacaatga 210  Q
2974734 tatgaactcaacaatga 2974718  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 91 - 210
Target Start/End: Complemental strand, 2952785 - 2952667
91 aacacctatttatataatattagaatttcaatctaatacaata--aacatgataatgaaaccattggaacaaacaacgtaaattggtgataataatgtca 188  Q
    |||||| |||||||| | |||| |||||||||||||| ||| |  || |   |||||||||||||| ||||||||||||| |||| | ||||||||   |    
2952785 aacacccatttatatgaaattacaatttcaatctaatgcaacacaaagagattaatgaaaccattgaaacaaacaacgtacattgataataataat---a 2952689  T
189 ataatcatgaactcaacaatga 210  Q
    ||||| ||||||||||||||||    
2952688 ataattatgaactcaacaatga 2952667  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 91 - 173
Target Start/End: Complemental strand, 2935436 - 2935353
91 aacacctatttatataatattagaatttcaatctaatacaata-aacatgataatgaaaccattggaacaaacaacgtaaattg 173  Q
    |||||| |||||||| | |||| |||||||||||||| ||| | || | |||||||||||||||| ||||||||||||| ||||    
2935436 aacacccatttatatgaaattacaatttcaatctaatgcaacacaaaaagataatgaaaccattgaaacaaacaacgtacattg 2935353  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 140 - 210
Target Start/End: Complemental strand, 2983650 - 2983577
140 ataatgaaaccattggaacaaacaacgtaaattggtgataat---aatgtcaataatcatgaactcaacaatga 210  Q
    ||||||||||||||| ||||||||||||| || |||||||||   |||  ||||||| ||||||||||||||||    
2983650 ataatgaaaccattgaaacaaacaacgtacatgggtgataatgagaataacaataattatgaactcaacaatga 2983577  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #7
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 140 - 210
Target Start/End: Original strand, 2996667 - 2996740
140 ataatgaaaccattggaacaaacaacgtaaattggtgataa---taatgtcaataatcatgaactcaacaatga 210  Q
    ||||||||||||||| |||||||||| || |||||||||||   ||||  ||||||| ||||||||||||||||    
2996667 ataatgaaaccattgaaacaaacaacttacattggtgataatactaatagcaataattatgaactcaacaatga 2996740  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #8
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 91 - 210
Target Start/End: Original strand, 3003010 - 3003131
91 aacacctatttatataatattagaatttcaatctaatacaata-aacatgataatgaaac-cattggaacaaacaacgtaaattggtgataataatgtca 188  Q
    ||||||||||||||| | |||| ||||||||||| || ||| | || | |||||||||||  |||| ||||||| ||||| |||| ||||||||||   |    
3003010 aacacctatttatatgaaattacaatttcaatctgatgcaacacaaaaagataatgaaacatattgaaacaaactacgtacattgatgataataataata 3003109  T
189 ataatcatgaactcaacaatga 210  Q
    ||||| ||||||| ||||||||    
3003110 ataattatgaacttaacaatga 3003131  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0024 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: scaffold0024

Target: scaffold0024; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 97 - 184
Target Start/End: Original strand, 43599 - 43689
97 tatttatataatattagaatttcaatctaat---acaataaacatgataatgaaaccattggaacaaacaacgtaaattggtgataataat 184  Q
    ||||||||| | |||| ||||||||||||||   |||| | |||  ||||||||||||||| ||||||||||||| |||||||||||||||    
43599 tatttatatgaaattacaatttcaatctaattacacaacacacaaaataatgaaaccattgaaacaaacaacgtacattggtgataataat 43689  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 126691 times since January 2019
Visitors: 1391