View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0095_high_5 (Length: 506)

Name: NF0095_high_5
Description: NF0095
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0095_high_5
NF0095_high_5
[»] chr2 (2 HSPs)
chr2 (30-294)||(42954495-42954760)
chr2 (395-497)||(42954290-42954392)


Alignment Details
Target: chr2 (Bit Score: 250; Significance: 1e-139; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 250; E-Value: 1e-139
Query Start/End: Original strand, 30 - 294
Target Start/End: Complemental strand, 42954760 - 42954495
Alignment:
30 gatttggtacgataaattatcattttatctgtgaacatgaaatgcaacaaagttctaaatgatttggtac-aataaaatagttagtataattgaatcttt 128  Q
    |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||    
42954760 gatttggtacgataaactatcattttatctgtgaacatgaaatgcaacaaagttctaaatgatttggtaccaataaaatagttagtataattgaatcttt 42954661  T
129 acatactaaaccgaacaataatcatatcacattgacttgatcttagtctttaattaatctgtgaataatgagattgagaaattaagtgtgaggagcatta 228  Q
    || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42954660 acctactaaaccgaacaataatcatatcacattgacttgatcttagtctttaattaatctgtgaataatgagattgagaaattaagtgtgaggagcatta 42954561  T
229 tgtacgcgcttaacatgagagtaaagtgctggatacagctaaaaactagtagttagaatgttgcaa 294  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42954560 tgtacgcgcttaacatgagagtaaagtgctggatacagctaaaaactagtagttagaatgttgcaa 42954495  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 91; E-Value: 7e-44
Query Start/End: Original strand, 395 - 497
Target Start/End: Complemental strand, 42954392 - 42954290
Alignment:
395 ttggtgattaattcctttcatatattctactaccactggtactttcttcttaatccaccttttagttaacctcaaaaccagaaacacactccctctattt 494  Q
    ||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||    
42954392 ttggtgattaattcctttcctatattctactaccactagtactttcttcttaatccaccttttagttaacctcaaaaccaaaaacacactccctctattt 42954293  T
495 cat 497  Q
    |||    
42954292 cat 42954290  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 149508 times since January 2019
Visitors: 1516