View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0095_high_50 (Length: 261)

Name: NF0095_high_50
Description: NF0095
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0095_high_50
NF0095_high_50
[»] chr8 (1 HSPs)
chr8 (1-194)||(354574-354767)


Alignment Details
Target: chr8 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 1 - 194
Target Start/End: Complemental strand, 354767 - 354574
Alignment:
1 tgttcttcaacaactctctcaggtaatcatttcgattcttttcagtatatgggtttgtgttcaaatttaacaatttgcgattgttctgtttttgatcggg 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
354767 tgttcttcaacaactctctcaggtaatcatttcgattcttttcagtatatgggtttgtgttcaaatttaacaatttgcgattgttctgtttttgatcggg 354668  T
101 gaaatttattcattttttatgtcggattttattggggaaatttaaaaatgcgattttaggttaaattcgtttctgggtcggtgttaaaatgcga 194  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
354667 gaaatttattcattttttatgtcggattttattggggaaatttaaaaatgcgattttaggttaaattcgtttctgggtcggtgttaaaatgcga 354574  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 150619 times since January 2019
Visitors: 1522