View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0095_high_51 (Length: 252)

Name: NF0095_high_51
Description: NF0095
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF0095_high_51
[»] chr4 (2 HSPs)
chr4 (28-252)||(3308930-3309161)
chr4 (66-121)||(3227787-3227842)

Alignment Details
Target: chr4 (Bit Score: 165; Significance: 2e-88; HSPs: 2)
Name: chr4

Target: chr4; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 28 - 252
Target Start/End: Complemental strand, 3309161 - 3308930
28 cataacaatacttttaagacgcgacagttccagcaccaacagttgccaagtcaacagatgcaattccatgcacattcaaacaaactttcacttt------ 121  Q
    |||||||| ||||||||||||||||| |||||| |||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||          
3309161 cataacaaaacttttaagacgcgacaattccagaaccaacagctgccaagtcaacaggtgcaattccatgcacattcaaacaaactttcactttcacttt 3309062  T
122 tgactttaagctttgtttaacatcattaacgtgctaatacatatacagaaaatatatcaattaagatgattgttaat-gtcagagataaatgatagatac 220  Q
    |||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||| |||||||||||||| ||||||||||||||||||||||    
3309061 tgactttaagctttgtttaacatcgttaacgtgctaatacatatatagaaaatatatcaattgagatgattgttaatcgtcagagataaatgatagatac 3308962  T
221 cagatactaaagttgtttaatttgtgatttat 252  Q
    ||||||||||||||||||||| ||||||||||    
3308961 cagatactaaagttgtttaatctgtgatttat 3308930  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 66 - 121
Target Start/End: Original strand, 3227787 - 3227842
66 acagttgccaagtcaacagatgcaattccatgcacattcaaacaaactttcacttt 121  Q
    ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||    
3227787 acagttgccaagtcaacagatgcaattccatgcacattcaaacgaactttcacttt 3227842  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 150749 times since January 2019
Visitors: 1522