View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0095_high_53 (Length: 251)

Name: NF0095_high_53
Description: NF0095
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF0095_high_53
[»] chr4 (3 HSPs)
chr4 (1-222)||(47064371-47064592)
chr4 (1-222)||(53301876-53302097)
chr4 (45-98)||(9764872-9764925)
[»] chr2 (3 HSPs)
chr2 (1-222)||(30268550-30268771)
chr2 (8-116)||(31332373-31332481)
chr2 (8-116)||(31339103-31339211)
[»] chr3 (1 HSPs)
chr3 (1-222)||(7404436-7404657)
[»] chr8 (1 HSPs)
chr8 (1-222)||(25640503-25640724)
[»] chr7 (1 HSPs)
chr7 (140-222)||(4683435-4683517)
[»] chr6 (1 HSPs)
chr6 (68-100)||(6761486-6761518)

Alignment Details
Target: chr4 (Bit Score: 222; Significance: 1e-122; HSPs: 3)
Name: chr4

Target: chr4; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 47064592 - 47064371
1 tccttgtgtttttatattgcttcaaacatgaaaagttacatttctcctatgcaatgggaagcttatacacacataaatcatccaaacaactaaacacata 100  Q
47064592 tccttgtgtttttatattgcttcaaacatgaaaagttacatttctcctatgcaatgggaagcttatacacacataaatcatccaaacaactaaacacata 47064493  T
101 aattgccaagtaaactaatctgaaaggttagctttcacactgtttgttcaattctaaatttctcatgccaaattgcagcattatagaactagttatcata 200  Q
47064492 aattgccaagtaaactaatctgaaaggttagctttcacactgtttgttcaattctaaatttctcatgccaaattgcagcattatagaactagttatcata 47064393  T
201 aatgtgaaaactatgcaaaatc 222  Q
47064392 aatgtgaaaactatgcaaaatc 47064371  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 53301876 - 53302097
1 tccttgtgtttttatattgcttcaaacatgaaaagttacatttctcctatgcaatgggaagcttatacacacataaatcatccaaacaactaaacacata 100  Q
53301876 tccttgtgtttttatattgcttcaaacatgaaaagttacatttctcctatgcaatgggaagcttatacacacataaatcatccaaacaactaaacacata 53301975  T
101 aattgccaagtaaactaatctgaaaggttagctttcacactgtttgttcaattctaaatttctcatgccaaattgcagcattatagaactagttatcata 200  Q
53301976 aattgccaagtaaactaatctgaaaggttagctttcacactgtttgttcaattctaaatttctcatgccaaattgcagcattatagaactagttatcata 53302075  T
201 aatgtgaaaactatgcaaaatc 222  Q
53302076 aatgtgaaaactatgcaaaatc 53302097  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 45 - 98
Target Start/End: Original strand, 9764872 - 9764925
45 tcctatgcaatgggaagcttatacacacataaatcatccaaacaactaaacaca 98  Q
    |||||||||| || ||| |||||||||||||||||| | || ||||||||||||    
9764872 tcctatgcaacggaaaggttatacacacataaatcaacaaagcaactaaacaca 9764925  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 222; Significance: 1e-122; HSPs: 3)
Name: chr2

Target: chr2; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 30268550 - 30268771
1 tccttgtgtttttatattgcttcaaacatgaaaagttacatttctcctatgcaatgggaagcttatacacacataaatcatccaaacaactaaacacata 100  Q
30268550 tccttgtgtttttatattgcttcaaacatgaaaagttacatttctcctatgcaatgggaagcttatacacacataaatcatccaaacaactaaacacata 30268649  T
101 aattgccaagtaaactaatctgaaaggttagctttcacactgtttgttcaattctaaatttctcatgccaaattgcagcattatagaactagttatcata 200  Q
30268650 aattgccaagtaaactaatctgaaaggttagctttcacactgtttgttcaattctaaatttctcatgccaaattgcagcattatagaactagttatcata 30268749  T
201 aatgtgaaaactatgcaaaatc 222  Q
30268750 aatgtgaaaactatgcaaaatc 30268771  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 97; E-Value: 9e-48
Query Start/End: Original strand, 8 - 116
Target Start/End: Complemental strand, 31332481 - 31332373
8 gtttttatattgcttcaaacatgaaaagttacatttctcctatgcaatgggaagcttatacacacataaatcatccaaacaactaaacacataaattgcc 107  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||    
31332481 gtttttatattgcttcaaacatgaaaagttacatttctcctatgcaatgggaagcttatacacacataaatcagccaaacaactaaacacatacattgcc 31332382  T
108 aagtaaact 116  Q
    |||| ||||    
31332381 aagtgaact 31332373  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 97; E-Value: 9e-48
Query Start/End: Original strand, 8 - 116
Target Start/End: Complemental strand, 31339211 - 31339103
8 gtttttatattgcttcaaacatgaaaagttacatttctcctatgcaatgggaagcttatacacacataaatcatccaaacaactaaacacataaattgcc 107  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||    
31339211 gtttttatattgcttcaaacatgaaaagttacatttctcctatgcaatgggaagcttatacacacataaatcagccaaacaactaaacacatacattgcc 31339112  T
108 aagtaaact 116  Q
    |||| ||||    
31339111 aagtgaact 31339103  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr3

Target: chr3; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 7404657 - 7404436
1 tccttgtgtttttatattgcttcaaacatgaaaagttacatttctcctatgcaatgggaagcttatacacacataaatcatccaaacaactaaacacata 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||    
7404657 tccttgtgtttttatattgcttcaaacatgaaaagttacatttctcctatgcaatgggaagcttatacacacataaatcagccaaacaactaaacacata 7404558  T
101 aattgccaagtaaactaatctgaaaggttagctttcacactgtttgttcaattctaaatttctcatgccaaattgcagcattatagaactag-ttatcat 199  Q
     |||||||||||||||||||||||||||||||||||| ||||||||||||| ||| |||||||||||||||||||||||||||||||||||| | |||||    
7404557 cattgccaagtaaactaatctgaaaggttagctttcatactgtttgttcaa-tctgaatttctcatgccaaattgcagcattatagaactagataatcat 7404459  T
200 aaatgtgaaaactatgcaaaatc 222  Q
7404458 aaatgtgaaaactatgcaaaatc 7404436  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr8

Target: chr8; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 25640503 - 25640724
1 tccttgtgtttttatattgcttcaaacatgaaaagttacatttctcctatgcaatgggaagcttatacacacataaatcatccaaacaactaaacacata 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||    
25640503 tccttgtgtttttatattgcttcaaacatgaaaagttacatttctcctatgcaatgggaagcttatacacacataaatcagccaaacaactaaacacata 25640602  T
101 aattgccaagtaaactaatctgaaaggttagctttcacactgtttgttcaattctaaatttctcatgccaaattgcagcattatagaactag-ttatcat 199  Q
     |||||||||||||||||||| ||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||| |||||||||||| | |||||    
25640603 cattgccaagtaaactaatcttaaaggttagctttcatactgtttgttcaa-tctaaatttctcatgccaaattgcagcgttatagaactagataatcat 25640701  T
200 aaatgtgaaaactatgcaaaatc 222  Q
25640702 aaatgtgaaaactatgcaaaatc 25640724  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 60; Significance: 1e-25; HSPs: 1)
Name: chr7

Target: chr7; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 140 - 222
Target Start/End: Complemental strand, 4683517 - 4683435
140 ctgtttgttcaattctaaatttctcatgccaaattgcagcattatagaactag-ttatcataaatgtgaaaactatgcaaaatc 222  Q
    ||||||||||||| |||||||||||||||||||||||||| |||||||||||| | ||||||||||||||||||||||||||||    
4683517 ctgtttgttcaat-ctaaatttctcatgccaaattgcagcgttatagaactagataatcataaatgtgaaaactatgcaaaatc 4683435  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr6

Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 68 - 100
Target Start/End: Original strand, 6761486 - 6761518
68 cacacataaatcatccaaacaactaaacacata 100  Q
    |||||||||||||||||||||||||| ||||||    
6761486 cacacataaatcatccaaacaactaatcacata 6761518  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 149635 times since January 2019
Visitors: 1517