View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0095_high_54 (Length: 250)

Name: NF0095_high_54
Description: NF0095
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF0095_high_54
[»] chr2 (3 HSPs)
chr2 (1-204)||(30782259-30782462)
chr2 (1-61)||(30245501-30245561)
chr2 (22-77)||(30061157-30061212)
[»] scaffold1178 (1 HSPs)
scaffold1178 (78-185)||(2225-2332)
[»] chr6 (3 HSPs)
chr6 (78-151)||(14434466-14434539)
chr6 (79-129)||(4479821-4479871)
chr6 (138-179)||(20737891-20737932)
[»] chr8 (4 HSPs)
chr8 (78-129)||(32850563-32850614)
chr8 (79-129)||(37177997-37178047)
chr8 (78-129)||(37173706-37173757)
chr8 (79-129)||(32854858-32854908)
[»] chr3 (1 HSPs)
chr3 (78-129)||(39163943-39163994)
[»] chr1 (1 HSPs)
chr1 (78-169)||(2009522-2009615)

Alignment Details
Target: chr2 (Bit Score: 192; Significance: 1e-104; HSPs: 3)
Name: chr2

Target: chr2; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 1 - 204
Target Start/End: Complemental strand, 30782462 - 30782259
1 tacaaaataaacattgctttcgcaggggtttgaactgaaatcatcatagcaactgcatcaggtcgtaattgaggttcgtgttaaatgataatttgtaatt 100  Q
    ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
30782462 tacaaaataaacattactttcgcaggggtttgaactgaaatcatcatagcaactgcatcaggtcgtaattgaggttcgtgttaaatgataatttgtaatt 30782363  T
101 ttccatatttctaggttccttaacgtatctagaaatccattcatgtatctgcaagttctagagagggtcatttaatattcctagggttttattagaactt 200  Q
    ||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
30782362 ttccatattcctaggttccttaatgtatctagaaatccattcatgtatctgcaagttctagagagggtcatttaatattcctagggttttattagaactt 30782263  T
201 tcta 204  Q
30782262 tcta 30782259  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 61
Target Start/End: Complemental strand, 30245561 - 30245501
1 tacaaaataaacattgctttcgcaggggtttgaactgaaatcatcatagcaactgcatcag 61  Q
    |||||| |||||||| |||| |||||||||| ||||||| |||||||||||||||||||||    
30245561 tacaaagtaaacattactttagcaggggtttaaactgaagtcatcatagcaactgcatcag 30245501  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 22 - 77
Target Start/End: Complemental strand, 30061212 - 30061157
22 gcaggggtttgaactgaaatcatcatagcaactgcatcaggtcgtaattgaggttc 77  Q
    |||||||||| ||| ||| ||||||||||| |||||||||||||||||||||||||    
30061212 gcaggggtttaaaccgaagtcatcatagcagctgcatcaggtcgtaattgaggttc 30061157  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold1178 (Bit Score: 64; Significance: 4e-28; HSPs: 1)
Name: scaffold1178

Target: scaffold1178; HSP #1
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 78 - 185
Target Start/End: Complemental strand, 2332 - 2225
78 gtgttaaatgataatttgtaattttccatatttctaggttccttaacgtatctagaaatccattcatgtatctgcaagttctagagagggtcatttaata 177  Q
    |||||||||||||||||||||||||||||||| |||||||||||||  |||||| || || ||||||||||| | |||||| |||||  |||||||||||    
2332 gtgttaaatgataatttgtaattttccatattcctaggttccttaatatatctaaaagtctattcatgtatcagtaagttccagagaatgtcatttaata 2233  T
178 ttcctagg 185  Q
2232 ttcctagg 2225  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 46; Significance: 2e-17; HSPs: 3)
Name: chr6

Target: chr6; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 78 - 151
Target Start/End: Original strand, 14434466 - 14434539
78 gtgttaaatgataatttgtaattttccatatttctaggttccttaacgtatctagaaatccattcatgtatctg 151  Q
    |||||||||||||||||||||||||||||||| |||||||| |||| |||||||||| ||  | ||||||||||    
14434466 gtgttaaatgataatttgtaattttccatattcctaggttcattaatgtatctagaagtctctccatgtatctg 14434539  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 79 - 129
Target Start/End: Complemental strand, 4479871 - 4479821
79 tgttaaatgataatttgtaattttccatatttctaggttccttaacgtatc 129  Q
    ||||||||||||||||||||||||||||||| ||||||||||||| |||||    
4479871 tgttaaatgataatttgtaattttccatattcctaggttccttaatgtatc 4479821  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 138 - 179
Target Start/End: Complemental strand, 20737932 - 20737891
138 cattcatgtatctgcaagttctagagagggtcatttaatatt 179  Q
    ||||||||||||||||||||||||| ||||||||||||||||    
20737932 cattcatgtatctgcaagttctagatagggtcatttaatatt 20737891  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 44; Significance: 4e-16; HSPs: 4)
Name: chr8

Target: chr8; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 78 - 129
Target Start/End: Complemental strand, 32850614 - 32850563
78 gtgttaaatgataatttgtaattttccatatttctaggttccttaacgtatc 129  Q
    |||||||||||||||||||||||||||||||| ||||||||||||| |||||    
32850614 gtgttaaatgataatttgtaattttccatattcctaggttccttaatgtatc 32850563  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 79 - 129
Target Start/End: Complemental strand, 37178047 - 37177997
79 tgttaaatgataatttgtaattttccatatttctaggttccttaacgtatc 129  Q
    ||||||||||||||||||||||||||||||| ||||||||||||| |||||    
37178047 tgttaaatgataatttgtaattttccatattcctaggttccttaatgtatc 37177997  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 78 - 129
Target Start/End: Complemental strand, 37173757 - 37173706
78 gtgttaaatgataatttgtaattttccatatttctaggttccttaacgtatc 129  Q
    ||||||||||||||||||||||||| |||||| ||||||||||||| |||||    
37173757 gtgttaaatgataatttgtaatttttcatattcctaggttccttaatgtatc 37173706  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 79 - 129
Target Start/End: Complemental strand, 32854908 - 32854858
79 tgttaaatgataatttgtaattttccatatttctaggttccttaacgtatc 129  Q
    ||||||||||||||||| ||||||||||||| ||||||||||||| |||||    
32854908 tgttaaatgataatttgaaattttccatattcctaggttccttaatgtatc 32854858  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 44; Significance: 4e-16; HSPs: 1)
Name: chr3

Target: chr3; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 78 - 129
Target Start/End: Complemental strand, 39163994 - 39163943
78 gtgttaaatgataatttgtaattttccatatttctaggttccttaacgtatc 129  Q
    |||||||||||||||||||||||||||||||| ||||||||||||| |||||    
39163994 gtgttaaatgataatttgtaattttccatattcctaggttccttaatgtatc 39163943  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr1

Target: chr1; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 78 - 169
Target Start/End: Original strand, 2009522 - 2009615
78 gtgttaaatgataatttgtaattttccatatttctaggttccttaacgtatctagaaatccattcatgtat---ctgcaagttctagagagggtc 169  Q
    |||||||||||||||| | |||||| |||||| ||| ||||| ||| |||||||||| | |||||||||||   || ||||||||| ||||||||    
2009522 gtgttaaatgataatt-gaaatttttcatattcctaagttccctaatgtatctagaagttcattcatgtattgactacaagttctaaagagggtc 2009615  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 151224 times since January 2019
Visitors: 1526