View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0095_high_55 (Length: 236)

Name: NF0095_high_55
Description: NF0095
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0095_high_55
NF0095_high_55
[»] chr4 (1 HSPs)
chr4 (30-236)||(998519-998725)


Alignment Details
Target: chr4 (Bit Score: 174; Significance: 9e-94; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 30 - 236
Target Start/End: Complemental strand, 998725 - 998519
Alignment:
30 ggaagatcactcaaaagtggagtcacttggggagtttttccagaagatcttaaagtgtcacagaaaaaaggatttgatcctcaagataagaatcttattt 129  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||    
998725 ggaagatcactcaaaagtggagtcacttggggagtttttccagaagatcttaaagtgtcacagaaaaaagtatttgatcctcaagataagaatcttcttt 998626  T
130 attggaacaagtttttcgagattctatgcatcctttctgtagcttgtgatcctttcnnnnnnnctcttccttatttcaaccacaaatcatattgtttagc 229  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||        ||||||||||||||||||||||||||||||||||||    
998625 attggaacaagtttttcgagattctatgcatcctttctgtagcttgtgatcctttctttttttatcttccttatttcaaccacaaatcatattgtttagc 998526  T
230 catagat 236  Q
    |||||||    
998525 catagat 998519  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 150564 times since January 2019
Visitors: 1522