View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0095_high_58 (Length: 227)

Name: NF0095_high_58
Description: NF0095
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF0095_high_58
[»] chr2 (5 HSPs)
chr2 (7-227)||(30782518-30782738)
chr2 (7-159)||(30245591-30245741)
chr2 (8-77)||(30005306-30005377)
chr2 (8-53)||(30062036-30062081)
chr2 (100-137)||(30782512-30782549)

Alignment Details
Target: chr2 (Bit Score: 217; Significance: 1e-119; HSPs: 5)
Name: chr2

Target: chr2; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 7 - 227
Target Start/End: Complemental strand, 30782738 - 30782518
7 aattcctcttttacaagacacgtgactttaacaacattatttatagtgtcaaggtctttataagttttatcgaaattaaggtctttatagtgtcaaatct 106  Q
30782738 aattcctcttttacaagacacgtgactttaacaacattatttatagtgtcaaggtctttataagttttatcgaaattaaggtctttatagtgtcaaatct 30782639  T
107 ggacataactcgctaatagagagcatcaaaaccattattgcaataaataacaagacacgttttgttgcaggtataaggactctctaccacaaatctggac 206  Q
    |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
30782638 ggacataactcgctaatagagagcataaaaaccattattgcaataaataacaagacacgttttgttgcaggtataaggactctctaccacaaatctggac 30782539  T
207 ataactcgctagtagagagca 227  Q
30782538 ataactcgctagtagagagca 30782518  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 114; E-Value: 6e-58
Query Start/End: Original strand, 7 - 159
Target Start/End: Complemental strand, 30245741 - 30245591
7 aattcctcttttacaagacacgtgactttaacaacattatttatagtgtcaaggtctttataagttttatcgaaattaaggtctttatagtgtcaaatct 106  Q
    |||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||| |||||||| ||||||  ||||||||||||||||||||    
30245741 aattcctcttttacaagaaacgtgactttaacaacattatttatagtgtcaaggtgtttataggttttatcaaaattatagtctttatagtgtcaaatct 30245642  T
107 ggacataactcgctaatagagagcatcaaaaccattattgcaataaataacaa 159  Q
    |||||||||||||||||||||||||||||||||||  |||||||||| |||||    
30245641 ggacataactcgctaatagagagcatcaaaaccat--ttgcaataaacaacaa 30245591  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 8 - 77
Target Start/End: Complemental strand, 30005377 - 30005306
8 attcctcttttacaagacacgtgactttaacaacattatttat--agtgtcaaggtctttataagttttatc 77  Q
    |||| ||||||  ||||||||||||||||||||||| ||||||  |||||||||||||||||| ||||||||    
30005377 attcatcttttctaagacacgtgactttaacaacatcatttatagagtgtcaaggtctttatatgttttatc 30005306  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 8 - 53
Target Start/End: Complemental strand, 30062081 - 30062036
8 attcctcttttacaagacacgtgactttaacaacattatttatagt 53  Q
    |||| ||||||  ||||||||||||||||||||||| |||||||||    
30062081 attcatcttttgtaagacacgtgactttaacaacatcatttatagt 30062036  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 100 - 137
Target Start/End: Complemental strand, 30782549 - 30782512
100 caaatctggacataactcgctaatagagagcatcaaaa 137  Q
    |||||||||||||||||||||| |||||||||| ||||    
30782549 caaatctggacataactcgctagtagagagcataaaaa 30782512  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 151023 times since January 2019
Visitors: 1525