View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0095_high_6 (Length: 505)

Name: NF0095_high_6
Description: NF0095
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF0095_high_6
[»] chr7 (4 HSPs)
chr7 (73-496)||(43070778-43071203)
chr7 (73-285)||(1262389-1262601)
chr7 (91-285)||(48849391-48849585)
chr7 (73-114)||(48849586-48849627)
[»] chr2 (5 HSPs)
chr2 (73-461)||(23348413-23348801)
chr2 (73-457)||(12741988-12742372)
chr2 (73-496)||(18354703-18355134)
chr2 (294-496)||(10328422-10328627)
chr2 (73-165)||(10328626-10328718)
[»] scaffold0596 (1 HSPs)
scaffold0596 (73-496)||(954-1378)
[»] chr3 (8 HSPs)
chr3 (73-461)||(19881544-19881932)
chr3 (73-496)||(53972682-53973107)
chr3 (73-312)||(37982652-37982891)
chr3 (304-462)||(37982939-37983097)
chr3 (73-285)||(31685377-31685575)
chr3 (29-84)||(43806781-43806836)
chr3 (218-263)||(17682201-17682246)
chr3 (218-263)||(19766443-19766488)
[»] chr5 (4 HSPs)
chr5 (73-457)||(9044102-9044486)
chr5 (73-457)||(7472922-7473310)
chr5 (73-457)||(30441983-30442368)
chr5 (341-423)||(40163917-40163996)
[»] chr8 (4 HSPs)
chr8 (73-286)||(14677630-14677843)
chr8 (73-278)||(31100488-31100693)
chr8 (73-278)||(5658071-5658261)
chr8 (80-214)||(33688978-33689112)
[»] scaffold0035 (1 HSPs)
scaffold0035 (73-286)||(35361-35574)
[»] chr4 (1 HSPs)
chr4 (73-286)||(29862969-29863182)
[»] scaffold0045 (1 HSPs)
scaffold0045 (73-286)||(11242-11455)
[»] chr6 (3 HSPs)
chr6 (73-278)||(33045062-33045252)
chr6 (81-219)||(22000988-22001126)
chr6 (73-286)||(10092793-10092985)

Alignment Details
Target: chr7 (Bit Score: 343; Significance: 0; HSPs: 4)
Name: chr7

Target: chr7; HSP #1
Raw Score: 343; E-Value: 0
Query Start/End: Original strand, 73 - 496
Target Start/End: Complemental strand, 43071203 - 43070778
73 ttatgtgttggaattcagattgttttaactcaaaaaattctcttcgccctttgagttgttcatcctccacctcactctcagacattcaaacaaaattctc 172  Q
    |||||||||||||||||||||| ||| |||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||    
43071203 ttatgtgttggaattcagattgcttttactcaaaaaaatctcttcgccctttgagttgttcatcttccacctcactctcagacattcaaacaaaattctc 43071104  T
173 tgccgttgccgctctctctgtcgccgcagctctctcctgtcgtcgcccttcaccaatgctctcgattctgacttcaccttcgacgttgtcgtctgcggca 272  Q
    |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||| |||||||||||||||||    
43071103 tgccgttgccgctctctccgtcgccgcagctctctcctgtcgtcgcccttcaccaatgctctcgattccgacatcaccttcgccgttgtcgtctgcggca 43071004  T
273 tcgtattagccaggtgtgttgaagatgctactatatatatcctaaatcgttgttcttgtaacttttccctaactttgttattccattatatttttggttt 372  Q
    |||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||    
43071003 tcgtatcagccaggtgtgttgaagatgctactatatatatcctaaatcgttgttcctgtaacttttccctaactttgttattccattacatttttggttt 43070904  T
373 gtttgtaagtgaattgatgatatttaaatagattttaccatcatgtattatgctattaataaattgattgatactttaaaatc--atgtgtannnnnnnn 470  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||  |||||||            
43070903 gtttgtaagtgaattgatgatatttaaatagattttaccatcatgtattatgctcttaataaattgattgatactttaaaatcatatgtgtatttttttt 43070804  T
471 caaacacaccaatatgtccattgatg 496  Q
43070803 caaacacaccaatatgtccattgatg 43070778  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 161; E-Value: 1e-85
Query Start/End: Original strand, 73 - 285
Target Start/End: Original strand, 1262389 - 1262601
73 ttatgtgttggaattcagattgttttaactcaaaaaattctcttcgccctttgagttgttcatcctccacctcactctcagacattcaaacaaaattctc 172  Q
    ||||||||||||||||| |||| ||| |||| ||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||    
1262389 ttatgtgttggaattcatattgcttttactcgaaaaaatctcttcgccctttgagttgttcatcttccacctcactctcagacattcaaacaaaattctc 1262488  T
173 tgccgttgccgctctctctgtcgccgcagctctctcctgtcgtcgcccttcaccaatgctctcgattctgacttcaccttcgacgttgtcgtctgcggca 272  Q
    ||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||| ||||||||| |||||||    
1262489 tgccgttgccgctttctccgtcgccgcagctctctcctgtcgtcgcccttcaccaatgctctcgattccgacatcaccttcgccgttgtcgtatgcggca 1262588  T
273 tcgtattagccag 285  Q
    |||||| ||||||    
1262589 tcgtatcagccag 1262601  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 151; E-Value: 1e-79
Query Start/End: Original strand, 91 - 285
Target Start/End: Complemental strand, 48849585 - 48849391
91 attgttttaactcaaaaaattctcttcgccctttgagttgttcatcctccacctcactctcagacattcaaacaaaattctctgccgttgccgctctctc 190  Q
    |||| ||| |||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||    
48849585 attgcttttactcaaaaaaatctcttcgccctttgagttgttcatcttccacctcactctcagacattcaaacaaaattctctgccgttgccgctttctc 48849486  T
191 tgtcgccgcagctctctcctgtcgtcgcccttcaccaatgctctcgattctgacttcaccttcgacgttgtcgtctgcggcatcgtattagccag 285  Q
     ||||||||||||||||||| ||||||||||||||||||||||||||||| ||| ||||||||| ||||||||||||||||||||||| ||||||    
48849485 cgtcgccgcagctctctcctttcgtcgcccttcaccaatgctctcgattccgacatcaccttcgccgttgtcgtctgcggcatcgtatcagccag 48849391  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 73 - 114
Target Start/End: Complemental strand, 48849627 - 48849586
73 ttatgtgttggaattcagattgttttaactcaaaaaattctc 114  Q
    |||||||||||||||||||||| ||| |||||||||| ||||    
48849627 ttatgtgttggaattcagattgcttttactcaaaaaaatctc 48849586  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 341; Significance: 0; HSPs: 5)
Name: chr2

Target: chr2; HSP #1
Raw Score: 341; E-Value: 0
Query Start/End: Original strand, 73 - 461
Target Start/End: Complemental strand, 23348801 - 23348413
73 ttatgtgttggaattcagattgttttaactcaaaaaattctcttcgccctttgagttgttcatcctccacctcactctcagacattcaaacaaaattctc 172  Q
    |||||||||||||||||||||| ||| |||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||    
23348801 ttatgtgttggaattcagattgcttttactcaaaaaaatctcttcgccctttgagttgttcatcttccacctcactctcagacattcaaacaaaattctc 23348702  T
173 tgccgttgccgctctctctgtcgccgcagctctctcctgtcgtcgcccttcaccaatgctctcgattctgacttcaccttcgacgttgtcgtctgcggca 272  Q
    |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||| |||||||||||||||||    
23348701 tgccgttgccgctctctccgtcgccgcagctctctcctgtcgtcgcccttcaccaatgctctcgattccgacatcaccttcgccgttgtcgtctgcggca 23348602  T
273 tcgtattagccaggtgtgttgaagatgctactatatatatcctaaatcgttgttcttgtaacttttccctaactttgttattccattatatttttggttt 372  Q
    |||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||    
23348601 tcgtatcagccaggtgtgttgaagatgctactatatatatcctaaatcgttgttcctgtaacttttccctaactttgttattccattacatttttggttt 23348502  T
373 gtttgtaagtgaattgatgatatttaaatagattttaccatcatgtattatgctattaataaattgattgatactttaaaatcatgtgt 461  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||    
23348501 gtttgtaagtgaattgatgatatttaaatagattttaccatcatgtattatgctgttaataaattgattgatactttaaaatcatgtgt 23348413  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 329; E-Value: 0
Query Start/End: Original strand, 73 - 457
Target Start/End: Original strand, 12741988 - 12742372
73 ttatgtgttggaattcagattgttttaactcaaaaaattctcttcgccctttgagttgttcatcctccacctcactctcagacattcaaacaaaattctc 172  Q
    |||||||||||||||||||||| ||| |||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||    
12741988 ttatgtgttggaattcagattgcttttactcaaaaaaatctcttcgccctttgagttgttcatcttccacctcactctcagacattcaaacaaaattctc 12742087  T
173 tgccgttgccgctctctctgtcgccgcagctctctcctgtcgtcgcccttcaccaatgctctcgattctgacttcaccttcgacgttgtcgtctgcggca 272  Q
    |||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||| |||||||||||||||||    
12742088 tgccgttgccgctctctccgccgccgcagctctctcctgtcgtcgcccttcaccaatgctctcgattccgacatcaccttcgtcgttgtcgtctgcggca 12742187  T
273 tcgtattagccaggtgtgttgaagatgctactatatatatcctaaatcgttgttcttgtaacttttccctaactttgttattccattatatttttggttt 372  Q
    |||||| ||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||    
12742188 tcgtatcagcaaggtgtgttgaagatgctactatatatatcctaaatcgttgttcctgtaacttttccctaactttgttattccattacatttttggttt 12742287  T
373 gtttgtaagtgaattgatgatatttaaatagattttaccatcatgtattatgctattaataaattgattgatactttaaaatcat 457  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||    
12742288 gtttgtaagtgaattgatgatatttaaatagattttaccatcatgtattatgctgttaataaattgattgatactttaaaatcat 12742372  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 302; E-Value: 1e-170
Query Start/End: Original strand, 73 - 496
Target Start/End: Complemental strand, 18355134 - 18354703
73 ttatgtgttggaattcagattgttttaactcaaaaaattctcttcgccctttgagttgttcatcctccacctcactctcagacattcaaacaaaattctc 172  Q
    |||||||||||||||||||||| ||| |||||||||| |||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||    
18355134 ttatgtgttggaattcagattgcttttactcaaaaaaatctcttcgccctttgagttgttcatcttccatctcactctcagacattcaaacaaaattctc 18355035  T
173 tgccgttgccgctctctctgtcgccgcagctctctcctgtcgtcgcccttcaccaatgctctcgattctgacttcaccttcgacgttgtcgtctgcggca 272  Q
    |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||  ||||| |||||||||     
18355034 tgccgttgccgctctctccgtcgccgcagctctctcctgtcgtcgcccttcaccaatgctctcgattccgacatcaccttcgctgttgttgtctgcggcg 18354935  T
273 tcgtattagccaggtgtgttgaagatgctactatat------atatcctaaatcgttgttcttgtaacttttccctaactttgttattccattatatttt 366  Q
    |||||| || ||||||||||||||||||||||||||      ||||||||||||||||||| |||| ||||||||||||||||||||||||||| |||||    
18354934 tcgtatcagtcaggtgtgttgaagatgctactatatatatatatatcctaaatcgttgttcctgtagcttttccctaactttgttattccattacatttt 18354835  T
367 tggtttgtttgtaagtgaattgatgatatttaaatagattttaccatcatgtattatgctattaataaattgattgatactttaaaatc--atgtgtann 464  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||  |||||||      
18354834 tggtttgtttgtaagtgaattgatgatatttaaatagattttaccatcatgtattatgctcttaataaattgattgatactttaaaatcatatgtgtatt 18354735  T
465 nnnnnncaaacacaccaatatgtccattgatg 496  Q
18354734 ttttttcaaacacaccaatatgtccattgatg 18354703  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 147; E-Value: 3e-77
Query Start/End: Original strand, 294 - 496
Target Start/End: Complemental strand, 10328627 - 10328422
294 aagatgctactatatatat--cctaaatcgttgttcttgtaacttttccctaactttgttattccattatatttttggtttgtttgtaagtgaattgatg 391  Q
    |||||||||||||||||||  ||||||||||||||| |||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||    
10328627 aagatgctactatatatatatcctaaatcgttgttcatgtatcttttccctaactttgttattccattacatttttggtttgtttgtaagtgaattgatg 10328528  T
392 atatttaaatagattttaccatcatgtattatgctattaataaattgattgatactttaaaatcatgtgta-nnnnnnnncaaacacaccaatatgtcca 490  Q
    ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||         ||||||||||||||||||||    
10328527 atatttaaatagattttaccatcatgtattatgctgttaataaattgattgatactttaaaatcatgtgtatttttttttcaaacacaccaatatgtcca 10328428  T
491 ttgatg 496  Q
10328427 ttgatg 10328422  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 73; E-Value: 4e-33
Query Start/End: Original strand, 73 - 165
Target Start/End: Complemental strand, 10328718 - 10328626
73 ttatgtgttggaattcagattgttttaactcaaaaaattctcttcgccctttgagttgttcatcctccacctcactctcagacattcaaacaa 165  Q
    ||||||||||||||| |||||| ||| |||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||    
10328718 ttatgtgttggaatttagattgcttttactcaaaaaaatctcttcgccctttgagttgttcatcttccacctcactctcagacattcaaacaa 10328626  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0596 (Bit Score: 325; Significance: 0; HSPs: 1)
Name: scaffold0596

Target: scaffold0596; HSP #1
Raw Score: 325; E-Value: 0
Query Start/End: Original strand, 73 - 496
Target Start/End: Original strand, 954 - 1378
73 ttatgtgttggaattcagattgttttaactcaaaaaattctcttcgccctttgagttgttcatcctccacctcactctcagacattcaaacaaaattctc 172  Q
    ||||||||||||||||| |||| ||| |||||||||| ||||||| |||||||||||||||||| ||||||||||||||||||||| |||||||||||||    
954 ttatgtgttggaattcaaattgcttttactcaaaaaaatctcttctccctttgagttgttcatcttccacctcactctcagacatttaaacaaaattctc 1053  T
173 tgccgttgccgctctctctgtcgccgcagctctctcctgtcgtcgcccttcaccaatgctctcgattctgacttcaccttcgacgttgtcgtctgcggca 272  Q
    |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||| |||| |||||||||||||||||    
1054 tgccgttgccgctctctccgtcgccgcagctctctcctgtcgtcgcccttcaccaatgctctcgattccgacatcactttcgccgttgtcgtctgcggca 1153  T
273 tcgtattagccaggtgtgttgaagatgctactatatatatcctaaatcgttgttcttgtaacttttccctaactttgttattccattatatttttggttt 372  Q
    |||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||    
1154 tcgtatcagccaggtgtgttgaagatgctactatatatatcctaaatcgttgttcctgtaacttttccctaactttgttattccattacatttttggttt 1253  T
373 gtttgtaagtgaattgatgatatttaaatagattttaccatcatgtattatgctattaataaattgattgatactttaaaatcatgtgta-nnnnnnnnc 471  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||         |    
1254 gtttgtaagtgaattgatgatatttaaatagattttaccatcatgtattatgctgttaataaattgattgatattttaaaatcatgtgtatttttttttc 1353  T
472 aaacacaccaatatgtccattgatg 496  Q
1354 aaacacaccaatatgtccattgatg 1378  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 325; Significance: 0; HSPs: 8)
Name: chr3

Target: chr3; HSP #1
Raw Score: 325; E-Value: 0
Query Start/End: Original strand, 73 - 461
Target Start/End: Complemental strand, 19881932 - 19881544
73 ttatgtgttggaattcagattgttttaactcaaaaaattctcttcgccctttgagttgttcatcctccacctcactctcagacattcaaacaaaattctc 172  Q
    |||||||||||||||||||||| ||| |||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||    
19881932 ttatgtgttggaattcagattgcttttactcaaaaaaatctcttcgccctttgagttgttcatcttccacctcactctcagacattcaaacaaaattctc 19881833  T
173 tgccgttgccgctctctctgtcgccgcagctctctcctgtcgtcgcccttcaccaatgctctcgattctgacttcaccttcgacgttgtcgtctgcggca 272  Q
    || ||||||||||||||| ||| |||||||||||||||||| || ||||||||||||||||||||||| ||| ||||||||| |||||||||||||||||    
19881832 tgtcgttgccgctctctccgtcaccgcagctctctcctgtcctcacccttcaccaatgctctcgattccgacatcaccttcgccgttgtcgtctgcggca 19881733  T
273 tcgtattagccaggtgtgttgaagatgctactatatatatcctaaatcgttgttcttgtaacttttccctaactttgttattccattatatttttggttt 372  Q
    |||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||    
19881732 tcgtatcagccaggtgtgttgaagatgctactatatatatcctaaatcgttgttcctgtaacttttccctaactttgttattccattacatttttggttt 19881633  T
373 gtttgtaagtgaattgatgatatttaaatagattttaccatcatgtattatgctattaataaattgattgatactttaaaatcatgtgt 461  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||    
19881632 gtttgtaagtgaattgatgatatttaaatagattttaccatcatgtattatgctgttaataaattgattgatactttaaaatcatgtgt 19881544  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 323; E-Value: 0
Query Start/End: Original strand, 73 - 496
Target Start/End: Complemental strand, 53973107 - 53972682
73 ttatgtgttggaattcagattgttttaactcaaaaaattctcttcgccctttgagttgttcatcctccacctcactctcagacattcaaacaaaattctc 172  Q
    |||||||||||||||||||||| ||| |||||||||| ||||||| |||||||||||||||||| ||||||||||||||||||||| |||||||||||||    
53973107 ttatgtgttggaattcagattgcttttactcaaaaaaatctcttctccctttgagttgttcatcttccacctcactctcagacatttaaacaaaattctc 53973008  T
173 tgccgttgccgctctctctgtcgccgcagctctctcctgtcgtcgcccttcaccaatgctctcgattctgacttcaccttcgacgttgtcgtctgcggca 272  Q
    || ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||| |||| |||||||||||||||||    
53973007 tgtcgttgccgctctctccgtcgccgcagctctctcctgtcgtcgcccttcaccaatgctctcgattccgacatcactttcgtcgttgtcgtctgcggca 53972908  T
273 tcgtattagccaggtgtgttgaagatgctactatatatatcctaaatcgttgttcttgtaacttttccctaactttgttattccattatatttttggttt 372  Q
    |||||| ||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||    
53972907 tcgtatcagccaagtgtgttgaagatgctactatatatatcctaaatcgttgttcctgtaacttttccctaactttgttattccattacatttttggttt 53972808  T
373 gtttgtaagtgaattgatgatatttaaatagattttaccatcatgtattatgctattaataaattgattgatactttaaaatcatgtgta--nnnnnnnn 470  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||              
53972807 gtttgtaagtgaattgatgatatttaaatagattttaccatcatgtattatgctgttaataaattgattgatactttaaaatcatgtgtatttttttttt 53972708  T
471 caaacacaccaatatgtccattgatg 496  Q
53972707 caaacacaccaatatgtccattgatg 53972682  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 184; E-Value: 2e-99
Query Start/End: Original strand, 73 - 312
Target Start/End: Original strand, 37982652 - 37982891
73 ttatgtgttggaattcagattgttttaactcaaaaaattctcttcgccctttgagttgttcatcctccacctcactctcagacattcaaacaaaattctc 172  Q
    |||||| ||||||||||||||| ||| |||||||||| |||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||    
37982652 ttatgttttggaattcagattgcttttactcaaaaaaatctcttcgccctctgagttgttcatcttccacctcactctcagacattcaaacaaaattctc 37982751  T
173 tgccgttgccgctctctctgtcgccgcagctctctcctgtcgtcgcccttcaccaatgctctcgattctgacttcaccttcgacgttgtcgtctgcggca 272  Q
    || ||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||| ||| ||||||||| |||||||||||||||||    
37982752 tgtcgttgccgctctctccgtcgccgcagctctctcctatcgtcgcccttcaccaatgctctcgattccgacatcaccttcgtcgttgtcgtctgcggca 37982851  T
273 tcgtattagccaggtgtgttgaagatgctactatatatat 312  Q
    |||||| ||||||||||||||||||||||| |||||||||    
37982852 tcgtatcagccaggtgtgttgaagatgctaatatatatat 37982891  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 147; E-Value: 3e-77
Query Start/End: Original strand, 304 - 462
Target Start/End: Original strand, 37982939 - 37983097
304 tatatatatcctaaatcgttgttcttgtaacttttccctaactttgttattccattatatttttggtttgtttgtaagtgaattgatgatatttaaatag 403  Q
    |||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
37982939 tatatatatcctaaatcgttgttcctgtaacttttccctaactttgttattccattacatttttggtttgtttgtaagtgaattgatgatatttaaatag 37983038  T
404 attttaccatcatgtattatgctattaataaattgattgatactttaaaatcatgtgta 462  Q
    ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||    
37983039 attttaccatcatgtattatgctgttaataaattgattgatactttaaaatcatgtgta 37983097  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 104; E-Value: 1e-51
Query Start/End: Original strand, 73 - 285
Target Start/End: Original strand, 31685377 - 31685575
73 ttatgtgttggaattcagattgttttaactcaaaaaat-tctcttcgccctttgagttgttcatcctccacctcactctcagacattcaaacaaaattct 171  Q
    ||||||||||||||||| |||| ||| ||||||||||  |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |    
31685377 ttatgtgttggaattcaaattgcttttactcaaaaaaaatctcttcgccctttgagttgttcatcttccacctcactctcagacattcaaacaaaattat 31685476  T
172 ctgccgttgccgctctctctgtcgccgcagctctctcctgtcgtcgcccttcaccaatgctctcgattctgacttcaccttcgacgttgtcgtctgcggc 271  Q
     |||||||               |||||||||||||||||||||||||||||||||||| | ||||||| ||| ||||||||| ||||||||||||||||    
31685477 atgccgtt---------------gccgcagctctctcctgtcgtcgcccttcaccaatgatatcgattccgacatcaccttcgccgttgtcgtctgcggc 31685561  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 29 - 84
Target Start/End: Original strand, 43806781 - 43806836
29 agatgtgacgcagaattgcttgttttcttcattggtatgatatattatgtgttgga 84  Q
    |||||||||||||||||||||||||||||||||||||||||||| ||||| |||||    
43806781 agatgtgacgcagaattgcttgttttcttcattggtatgatataatatgttttgga 43806836  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 218 - 263
Target Start/End: Original strand, 17682201 - 17682246
218 cccttcaccaatgctctcgattctgacttcaccttcgacgttgtcg 263  Q
    ||||||||||||||||||||||| ||| ||||||| | ||||||||    
17682201 cccttcaccaatgctctcgattccgacatcacctttgccgttgtcg 17682246  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 218 - 263
Target Start/End: Original strand, 19766443 - 19766488
218 cccttcaccaatgctctcgattctgacttcaccttcgacgttgtcg 263  Q
    ||||||||||||||||| ||||| ||| ||||||||| ||||||||    
19766443 cccttcaccaatgctctagattccgacatcaccttcgccgttgtcg 19766488  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 321; Significance: 0; HSPs: 4)
Name: chr5

Target: chr5; HSP #1
Raw Score: 321; E-Value: 0
Query Start/End: Original strand, 73 - 457
Target Start/End: Original strand, 9044102 - 9044486
73 ttatgtgttggaattcagattgttttaactcaaaaaattctcttcgccctttgagttgttcatcctccacctcactctcagacattcaaacaaaattctc 172  Q
    |||||||||||||||||||||| ||| |||||||||| | |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||    
9044102 ttatgtgttggaattcagattgcttttactcaaaaaaatttcttcgccctttgagttgttcatcttccacctcactctcagacattcaaacaaaattctc 9044201  T
173 tgccgttgccgctctctctgtcgccgcagctctctcctgtcgtcgcccttcaccaatgctctcgattctgacttcaccttcgacgttgtcgtctgcggca 272  Q
    |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||  ||| ||||||||| ||||||||||||| |||    
9044202 tgccgttgccgctctctccgtcgccgcagctctctcctgtcgtcgcccttcaccaatgctctcgatttcgacatcaccttcgtcgttgtcgtctgcagca 9044301  T
273 tcgtattagccaggtgtgttgaagatgctactatatatatcctaaatcgttgttcttgtaacttttccctaactttgttattccattatatttttggttt 372  Q
    |||||| ||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||    
9044302 tcgtatcagccaagtgtgttgaagatgctactatatatatcctaaatcgttgttcctgtaacttttccctaactttgttattccattacatttttggttt 9044401  T
373 gtttgtaagtgaattgatgatatttaaatagattttaccatcatgtattatgctattaataaattgattgatactttaaaatcat 457  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||    
9044402 gtttgtaagtgaattgatgatatttaaatagattttaccatcatgtattatgctgttaataaattgattgatactttaaaatcat 9044486  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 316; E-Value: 1e-178
Query Start/End: Original strand, 73 - 457
Target Start/End: Complemental strand, 7473310 - 7472922
73 ttatgtgttggaattcagattgttttaactcaaaaaattctcttcgccctttgagttgttcatcctccacctcactctcagacattcaaacaaaattctc 172  Q
    ||||||||||||||| |||||| ||| |||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||    
7473310 ttatgtgttggaatttagattgcttttactcaaaaaaatctcttcgccctttgagttgttcatcttccacctcactctcagacattcaaacaaaattctc 7473211  T
173 tgccgttgccgctctctctgtcgccgcagctctctcctgtcgtcgcccttcaccaatgctctcgattctgacttcaccttcgacgttgtcgtctgcggca 272  Q
    |||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||| |||||||||||||||||    
7473210 tgccgttgtcgctctctccgtcgccgcagctctctcctgtcgtcgcccttcaccaatgctctcgattccgacatcaccttcgccgttgtcgtctgcggca 7473111  T
273 tcgtattagccaggtgtgttgaagatgctactatat----atatcctaaatcgttgttcttgtaacttttccctaactttgttattccattatatttttg 368  Q
    |||||| |||||||||||||||||||||||||||||    ||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||    
7473110 tcgtatcagccaggtgtgttgaagatgctactatatatatatatcctaaatcgttgttcctgtaacttttccctaactttgttattccattacatttttg 7473011  T
369 gtttgtttgtaagtgaattgatgatatttaaatagattttaccatcatgtattatgctattaataaattgattgatactttaaaatcat 457  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||    
7473010 gtttgtttgtaagtgaattgatgatatttaaatagattttaccatcatgtattatgctgttaataaattgattgatactttaaaatcat 7472922  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 306; E-Value: 1e-172
Query Start/End: Original strand, 73 - 457
Target Start/End: Complemental strand, 30442368 - 30441983
73 ttatgtgttggaattcagattgttttaactcaaaaaat-tctcttcgccctttgagttgttcatcctccacctcactctcagacattcaaacaaaattct 171  Q
    |||||||||||||||||||||| ||| ||||||||||  |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||    
30442368 ttatgtgttggaattcagattgcttttactcaaaaaaaatctcttcgccctttgagttgttcatcttccacctcactctcagacattcaaacaaaattct 30442269  T
172 ctgccgttgccgctctctctgtcgccgcagctctctcctgtcgtcgcccttcaccaatgctctcgattctgacttcaccttcgacgttgtcgtctgcggc 271  Q
    ||| ||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||| | ||||||||||||||||    
30442268 ctgtcgttgccgctctctccgttgccgcagctctctcctgtcgtcgcccttcaccaatgctctcgattccgacatcaccttggccgttgtcgtctgcggc 30442169  T
272 atcgtattagccaggtgtgttgaagatgctactatatatatcctaaatcgttgttcttgtaacttttccctaactttgttattccattatatttttggtt 371  Q
    ||||||| |||||  ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||    
30442168 atcgtatcagccatatgtgttgaagatgctactatatatatcctaaatcgttgttcctgtaacttttccctaactttgttattccattacatttttggtt 30442069  T
372 tgtttgtaagtgaattgatgatatttaaatagattttaccatcatgtattatgctattaataaattgattgatactttaaaatcat 457  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||    
30442068 tgtttgtaagtgaattgatgatatttaaatagattttaccatcatgtattatgttgttaataaattgattgatactttaaaatcat 30441983  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 341 - 423
Target Start/End: Original strand, 40163917 - 40163996
341 ctaactttgttattccattatatttttggtttgtttgtaagtgaattgatgatatttaaatagattttaccatcatgtattat 423  Q
    ||||||||||||||||||||||| ||| ||||||||| | ||||||   ||||||||| ||||||||||| || |||||||||    
40163917 ctaactttgttattccattatatatttagtttgtttggatgtgaat---tgatatttacatagattttacaattatgtattat 40163996  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 150; Significance: 4e-79; HSPs: 4)
Name: chr8

Target: chr8; HSP #1
Raw Score: 150; E-Value: 4e-79
Query Start/End: Original strand, 73 - 286
Target Start/End: Complemental strand, 14677843 - 14677630
73 ttatgtgttggaattcagattgttttaactcaaaaaattctcttcgccctttgagttgttcatcctccacctcactctcagacattcaaacaaaattctc 172  Q
    |||||||||| ||||||||||| ||| |||||||||| ||||||  |||||||||||||||||| ||||||||||||||||||||||||||||||| |||    
14677843 ttatgtgttgaaattcagattgcttttactcaaaaaaatctctttcccctttgagttgttcatcttccacctcactctcagacattcaaacaaaatcctc 14677744  T
173 tgccgttgccgctctctctgtcgccgcagctctctcctgtcgtcgcccttcaccaatgctctcgattctgacttcaccttcgacgttgtcgtctgcggca 272  Q
    |||||||||||||||||| ||||||||||||||||||| ||||| ||||||||||||||||||||||| ||| ||||||||| ||||||||||||| |||    
14677743 tgccgttgccgctctctccgtcgccgcagctctctcctatcgtcacccttcaccaatgctctcgattccgacatcaccttcgccgttgtcgtctgcagca 14677644  T
273 tcgtattagccagg 286  Q
    |||||| |||||||    
14677643 tcgtatcagccagg 14677630  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 146; E-Value: 1e-76
Query Start/End: Original strand, 73 - 278
Target Start/End: Complemental strand, 31100693 - 31100488
73 ttatgtgttggaattcagattgttttaactcaaaaaattctcttcgccctttgagttgttcatcctccacctcactctcagacattcaaacaaaattctc 172  Q
    |||||||||||||||||||||| ||| |||||||||| ||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||     
31100693 ttatgtgttggaattcagattgcttttactcaaaaaaatctcttccccctttgagttgttcatcttccacctcactctcagacattcaaacaaaattctt 31100594  T
173 tgccgttgccgctctctctgtcgccgcagctctctcctgtcgtcgcccttcaccaatgctctcgattctgacttcaccttcgacgttgtcgtctgcggca 272  Q
    |||||| ||| ||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||  || ||||||||| |||||||||||| ||||    
31100593 tgccgtcgccactctctccgtcgccgcaactctctcctgtcgtcgcccttcaccaatgctctcgattccaacatcaccttcgccgttgtcgtctgtggca 31100494  T
273 tcgtat 278  Q
31100493 tcgtat 31100488  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 108; E-Value: 5e-54
Query Start/End: Original strand, 73 - 278
Target Start/End: Original strand, 5658071 - 5658261
73 ttatgtgttggaattcagattgttttaactcaaaaaattctcttcgccctttgagttgttcatcctccacctcactctcagacattcaaacaaaattctc 172  Q
    |||||||||||||||||||||| ||| |||||||||| ||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||     
5658071 ttatgtgttggaattcagattgcttttactcaaaaaaatctcttccccctttgagttgttcatcttccacctcactctcagacattcaaacaaaattctt 5658170  T
173 tgccgttgccgctctctctgtcgccgcagctctctcctgtcgtcgcccttcaccaatgctctcgattctgacttcaccttcgacgttgtcgtctgcggca 272  Q
    ||||               ||||||||||||||||||||||||||||||||||||||||||| |||||  || ||||||||| |||||||||||| ||||    
5658171 tgcc---------------gtcgccgcagctctctcctgtcgtcgcccttcaccaatgctcttgattccaacatcaccttcgccgttgtcgtctgtggca 5658255  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 76; E-Value: 6e-35
Query Start/End: Original strand, 80 - 214
Target Start/End: Complemental strand, 33689112 - 33688978
80 ttggaattcagattgttttaactcaaaaaattctcttcgccctttgagttgttcatcctccacctcactctcagacattcaaacaa-aattctctgccgt 178  Q
    ||||||||||||||| ||| |||||||||| ||||||| |||||||||||||||||| ||||||||||||| |||||||||||||| | |||||| || |    
33689112 ttggaattcagattgcttttactcaaaaaaatctcttc-ccctttgagttgttcatcttccacctcactcttagacattcaaacaagacttctctcccat 33689014  T
179 tgccgctctctctgtcgccgcagctctctcctgtcg 214  Q
     ||||||||||| ||||||||||||||||| |||||    
33689013 cgccgctctctccgtcgccgcagctctctcatgtcg 33688978  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0035 (Bit Score: 142; Significance: 3e-74; HSPs: 1)
Name: scaffold0035

Target: scaffold0035; HSP #1
Raw Score: 142; E-Value: 3e-74
Query Start/End: Original strand, 73 - 286
Target Start/End: Original strand, 35361 - 35574
73 ttatgtgttggaattcagattgttttaactcaaaaaattctcttcgccctttgagttgttcatcctccacctcactctcagacattcaaacaaaattctc 172  Q
    ||||| |||||||||||||||| ||| |||||||||| ||  ||  |||||||||||||||||| |||||||||||||||||||||||||||||||||||    
35361 ttatgagttggaattcagattgcttttactcaaaaaaatcgttttcccctttgagttgttcatcttccacctcactctcagacattcaaacaaaattctc 35460  T
173 tgccgttgccgctctctctgtcgccgcagctctctcctgtcgtcgcccttcaccaatgctctcgattctgacttcaccttcgacgttgtcgtctgcggca 272  Q
    ||||||||| |||||||| |||||||||||||||||||||||||||| || ||| ||||||||||||||||| ||||||||| ||||||||| |||||||    
35461 tgccgttgctgctctctccgtcgccgcagctctctcctgtcgtcgcctttgaccgatgctctcgattctgacatcaccttcgccgttgtcgtttgcggca 35560  T
273 tcgtattagccagg 286  Q
    |||||| |||||||    
35561 tcgtatcagccagg 35574  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 142; Significance: 3e-74; HSPs: 1)
Name: chr4

Target: chr4; HSP #1
Raw Score: 142; E-Value: 3e-74
Query Start/End: Original strand, 73 - 286
Target Start/End: Complemental strand, 29863182 - 29862969
73 ttatgtgttggaattcagattgttttaactcaaaaaattctcttcgccctttgagttgttcatcctccacctcactctcagacattcaaacaaaattctc 172  Q
    ||||||||| |||||||||||| ||| |||||||||| ||||||  |||||||||||||||||| |||||||||||||||||||||||||||||||||||    
29863182 ttatgtgttagaattcagattgcttttactcaaaaaaatctctttcccctttgagttgttcatcttccacctcactctcagacattcaaacaaaattctc 29863083  T
173 tgccgttgccgctctctctgtcgccgcagctctctcctgtcgtcgcccttcaccaatgctctcgattctgacttcaccttcgacgttgtcgtctgcggca 272  Q
    || || |||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||| ||| |||| || | ||||||| |||||||||    
29863082 tgtcgctgccgctctctccgtcgccgcagctctctcctgtcgtcgcccttcaccgatgctctcgattccgacatcacttttgccgttgtcatctgcggca 29862983  T
273 tcgtattagccagg 286  Q
    |||||| |||||||    
29862982 tcgtatcagccagg 29862969  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0045 (Bit Score: 126; Significance: 9e-65; HSPs: 1)
Name: scaffold0045

Target: scaffold0045; HSP #1
Raw Score: 126; E-Value: 9e-65
Query Start/End: Original strand, 73 - 286
Target Start/End: Complemental strand, 11455 - 11242
73 ttatgtgttggaattcagattgttttaactcaaaaaattctcttcgccctttgagttgttcatcctccacctcactctcagacattcaaacaaaattctc 172  Q
    |||||||||||||||||||||| ||| ||||||| || || |||| |||||||||||||||||| |||||||||||| |||||||||||||||||||||     
11455 ttatgtgttggaattcagattgcttttactcaaacaaatcccttccccctttgagttgttcatcttccacctcactcccagacattcaaacaaaattctt 11356  T
173 tgccgttgccgctctctctgtcgccgcagctctctcctgtcgtcgcccttcaccaatgctctcgattctgacttcaccttcgacgttgtcgtctgcggca 272  Q
    ||  ||  |||||||||| ||||||||||||||||| |||||||||||||||||||||||||||| || ||| ||||||||| |||||||||||||||||    
11355 tgttgtcaccgctctctccgtcgccgcagctctctcttgtcgtcgcccttcaccaatgctctcgaatccgacatcaccttcgccgttgtcgtctgcggca 11256  T
273 tcgtattagccagg 286  Q
    | | || |||||||    
11255 ttgcatcagccagg 11242  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 108; Significance: 5e-54; HSPs: 3)
Name: chr6

Target: chr6; HSP #1
Raw Score: 108; E-Value: 5e-54
Query Start/End: Original strand, 73 - 278
Target Start/End: Complemental strand, 33045252 - 33045062
73 ttatgtgttggaattcagattgttttaactcaaaaaattctcttcgccctttgagttgttcatcctccacctcactctcagacattcaaacaaaattctc 172  Q
    |||||||||||||||||||||| ||| |||||||||| ||||||| |||||||||||||||||| || |||||||||||||||||||||||||||||||     
33045252 ttatgtgttggaattcagattgcttttactcaaaaaaatctcttccccctttgagttgttcatcttcaacctcactctcagacattcaaacaaaattctt 33045153  T
173 tgccgttgccgctctctctgtcgccgcagctctctcctgtcgtcgcccttcaccaatgctctcgattctgacttcaccttcgacgttgtcgtctgcggca 272  Q
    || |               |||||||||||||||||||||||||||||||||||||||||||||||||  || ||||||||| |||||||||||||||||    
33045152 tgtc---------------gtcgccgcagctctctcctgtcgtcgcccttcaccaatgctctcgattccaacatcaccttcgtcgttgtcgtctgcggca 33045068  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 99; E-Value: 1e-48
Query Start/End: Original strand, 81 - 219
Target Start/End: Complemental strand, 22001126 - 22000988
81 tggaattcagattgttttaactcaaaaaattctcttcgccctttgagttgttcatcctccacctcactctcagacattcaaacaaaattctctgccgttg 180  Q
    ||||||| | |||| ||| |||||||||| ||||||| |||||||||||||||||| ||||||||||| ||||||||||||||||||||||||| |||||    
22001126 tggaatttatattgcttttactcaaaaaaatctcttccccctttgagttgttcatcttccacctcactttcagacattcaaacaaaattctctgtcgttg 22001027  T
181 ccgctctctctgtcgccgcagctctctcctgtcgtcgcc 219  Q
    |||||||||| ||||||||||||||||||||||||||||    
22001026 ccgctctctccgtcgccgcagctctctcctgtcgtcgcc 22000988  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 89; E-Value: 1e-42
Query Start/End: Original strand, 73 - 286
Target Start/End: Original strand, 10092793 - 10092985
73 ttatgtgttggaattcagattgttttaactcaaaaaattctcttcgccctttgagttgttcatcctccacctcactctcagacattcaaacaaaattctc 172  Q
    ||||||||||||||||| |||| ||| |||||||||| |||||||  ||||| ||||||||||| |||||||||||||||||||||||||||||||||||    
10092793 ttatgtgttggaattcaaattgcttttactcaaaaaaatctcttc--cctttaagttgttcatcttccacctcactctcagacattcaaacaaaattctc 10092890  T
173 tgccgttgccgctctctctgtcgccgcagctctctcctgtcgtcgcccttcaccaatgctctcgattctgacttcaccttcgacgttgtcgtctgcggca 272  Q
    |  ||| ||||||||||                   |||||||||||||||||||||||||||||||| ||| ||||||||| |||||||||||||||||    
10092891 taacgtcgccgctctct-------------------ctgtcgtcgcccttcaccaatgctctcgattccgacatcaccttcgtcgttgtcgtctgcggca 10092971  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 150879 times since January 2019
Visitors: 1524