View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0095_high_7 (Length: 496)

Name: NF0095_high_7
Description: NF0095
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0095_high_7
NF0095_high_7
[»] chr8 (5 HSPs)
chr8 (12-469)||(29115213-29115665)
chr8 (13-263)||(24423256-24423497)
chr8 (12-72)||(9818241-9818301)
chr8 (12-72)||(21231912-21231972)
chr8 (12-72)||(9881119-9881179)
[»] chr7 (8 HSPs)
chr7 (10-308)||(31211120-31211411)
chr7 (43-341)||(46002473-46002764)
chr7 (12-115)||(46002764-46002867)
chr7 (13-72)||(8311763-8311822)
chr7 (26-77)||(9745169-9745220)
chr7 (12-72)||(10530204-10530264)
chr7 (12-72)||(29587606-29587666)
chr7 (409-462)||(46002357-46002411)
[»] chr3 (4 HSPs)
chr3 (14-120)||(11650541-11650647)
chr3 (22-89)||(19544707-19544773)
chr3 (13-72)||(52641395-52641454)
chr3 (26-72)||(29453693-29453738)
[»] chr1 (3 HSPs)
chr1 (10-70)||(24304411-24304471)
chr1 (12-72)||(51443589-51443649)
chr1 (12-72)||(31654638-31654698)
[»] chr2 (3 HSPs)
chr2 (13-67)||(22403780-22403834)
chr2 (12-72)||(27977214-27977274)
chr2 (12-72)||(28063742-28063802)
[»] chr5 (2 HSPs)
chr5 (184-340)||(18926891-18927046)
chr5 (10-51)||(18927186-18927227)
[»] scaffold0022 (1 HSPs)
scaffold0022 (12-72)||(2054-2114)
[»] scaffold0259 (1 HSPs)
scaffold0259 (13-72)||(2566-2625)
[»] scaffold0016 (1 HSPs)
scaffold0016 (12-72)||(107887-107947)
[»] chr4 (1 HSPs)
chr4 (12-72)||(41943081-41943141)


Alignment Details
Target: chr8 (Bit Score: 354; Significance: 0; HSPs: 5)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 354; E-Value: 0
Query Start/End: Original strand, 12 - 469
Target Start/End: Complemental strand, 29115665 - 29115213
Alignment:
12 atgaaaatagtaggttatgatattgaatttgatatgcttcatgattcgatggatgagtgaa-gatatgaattattattaatagatataacaatttttgtt 110  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||| ||||||||||| |||||    
29115665 atgaaaatagtaggttatgatattgaatttgatatgcttcatgattcgatggatgagtgaaagatattaattattattaataaatataacaattgttgtt 29115566  T
111 tagtaattttgttnnnnnnnttgattttgtagaataggtgaattttgataacattatacgtatgattgttgatttgtggaattggtaatttgttgattta 210  Q
    |||||||||||||       |||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||    
29115565 tagtaattttgttaaaaaaattgattttgttgaataggtgaattttgataacattatacgtatgattgttgatttgcggaattggtaatttgttgattta 29115466  T
211 tatatatgattgttgatatgtgaaattgagaattttattgatttcaagtgactttccgttaattttatctttagatgtttaaagaaattttattaattat 310  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
29115465 tatatatgattgttgatatgtgaaattgagaattttattgatttcaagtgactttccgttgattttatctttagatgtttaaagaaattttattaattat 29115366  T
311 gaggagtttgtgattttatggaattgataaggtggtttgtgagtataaaactacaagatttaaggaaagattacattgcatgcataa-attgcatataaa 409  Q
    |||||||||||||||||||||||||||||||||||||| ||||         ||||||||||||||||||||||||||||||||||| ||||||||||||    
29115365 gaggagtttgtgattttatggaattgataaggtggtttctgag---------acaagatttaaggaaagattacattgcatgcataacattgcatataaa 29115275  T
410 gcatagcatataatagtgtcataagtgttaaatgggggattcata--tccatgtgttaaatg 469  Q
    |||||||||||||||||||||||||||||||||||||||||||||  |||||||||||||||    
29115274 gcatagcatataatagtgtcataagtgttaaatgggggattcatatctccatgtgttaaatg 29115213  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 13 - 263
Target Start/End: Original strand, 24423256 - 24423497
Alignment:
13 tgaaaatagtaggttatgatattgaatttgatatgcttcatgattcgatggatgagtgaagatatgaattattattaatagatataacaatttttgttta 112  Q
    |||||||  ||| ||||||||||||||||  |||||||| | ||||  |||||||||||||| || |||  ||||||||| |||||| |||| |||||||    
24423256 tgaaaatgatagtttatgatattgaattttgtatgcttctt-attcattggatgagtgaagagattaatggttattaataaatataataattgttgttta 24423354  T
113 gtaa-ttttgttnnnnnnnttgattttgtagaataggtgaattttgataacattatacgtatgattgttgatttgtggaattggtaatttgttgatttat 211  Q
    |||| |||||||       |||| || | |||||| ||||||||||||||  ||||| ||||||||| | | ||| | ||||||||||||||||||  ||    
24423355 gtaaattttgtta------ttgaatt-gaagaatatgtgaattttgataa--ttataagtatgattgattagttgcgaaattggtaatttgttgatcgat 24423445  T
212 atatatgattgttgatatgtgaaattgagaattttattgatttcaagtgact 263  Q
     |||||||||||| ||||| | ||||| || |||||||||||| | ||||||    
24423446 gtatatgattgttaatatgcggaattgtgatttttattgatttaatgtgact 24423497  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 12 - 72
Target Start/End: Complemental strand, 9818301 - 9818241
Alignment:
12 atgaaaatagtaggttatgatattgaatttgatatgcttcatgattcgatggatgagtgaa 72  Q
    ||||||||  ||| ||||||| |||||||||||||||||| |||||  |||||||||||||    
9818301 atgaaaatgatagattatgatgttgaatttgatatgcttcttgatttaatggatgagtgaa 9818241  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 12 - 72
Target Start/End: Complemental strand, 21231972 - 21231912
Alignment:
12 atgaaaatagtaggttatgatattgaatttgatatgcttcatgattcgatggatgagtgaa 72  Q
    ||||||||  ||| ||||||| |||||||||||||||||| |||||  |||||||||||||    
21231972 atgaaaatgatagattatgatgttgaatttgatatgcttcttgatttaatggatgagtgaa 21231912  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 12 - 72
Target Start/End: Original strand, 9881119 - 9881179
Alignment:
12 atgaaaatagtaggttatgatattgaatttgatatgcttcatgattcgatggatgagtgaa 72  Q
    ||||||||| ||| ||||||| || ||||||||||||||   ||||| |||||||||||||    
9881119 atgaaaataatagattatgatcttaaatttgatatgcttatcgattcaatggatgagtgaa 9881179  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 111; Significance: 8e-56; HSPs: 8)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 111; E-Value: 8e-56
Query Start/End: Original strand, 10 - 308
Target Start/End: Original strand, 31211120 - 31211411
Alignment:
10 agatgaaaatagtaggttatgatattgaatttgatatgcttcatgattcgatggatgagtgaagatatgaattattattaatagatataacaatttttgt 109  Q
    ||||||||||| |||||||||||||| ||||||||||||||| |||||  || |||| ||||||| || |||| ||||||||| |||||| |||| ||||    
31211120 agatgaaaataataggttatgatattaaatttgatatgcttcttgatttaatagatgcgtgaagagattaattcttattaataaatataagaattgttgt 31211219  T
110 ttagtaa-ttttgttnnnnnnnttgattttgtagaataggtgaattttgataacattatacgtatgattgttgatttgtggaattggtaatttgttgatt 208  Q
    ||||||| |||||||       ||||||||  |||||| ||||||||||||||  |||||| |||||||| |   ||||| |||||||||||||||||||    
31211220 ttagtaaattttgtta------ttgattttaaagaatatgtgaattttgataa--ttatacttatgattgatttgttgtgaaattggtaatttgttgatt 31211311  T
209 tatatatatgattgttgatatgtgaaattgagaattttattgatttcaagtgactttccgttaattttatctttagatgtttaaagaaattttattaatt 308  Q
     || |||||||||||||||||||||||||| | |||||| |||||| | |||||| | |||| ||||| |||||||| ||||  ||||||||||||||||    
31211312 gatgtatatgattgttgatatgtgaaattgtggattttagtgatttaaggtgactcttcgttgattttgtctttagaggttttgagaaattttattaatt 31211411  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 80; E-Value: 3e-37
Query Start/End: Original strand, 43 - 341
Target Start/End: Complemental strand, 46002764 - 46002473
Alignment:
43 atatgcttcatgattcgatggatgagtgaagatatgaattattattaatagatataacaatttttgtttagtaatttt-gttnnnnnnnttgattttgta 141  Q
    ||||||||| |||||| || |||||||||| | || |||| ||||||||| |||||| |||| ||| ||||||||||| |||       ||||||||| |    
46002764 atatgcttcttgattctattgatgagtgaaaagattaattgttattaataaatataagaattgttggttagtaatttttgtta------ttgattttgaa 46002671  T
142 gaataggtgaattttgataacattatacgtatgattgttgatttgtggaattggtaatttgtt-gatttatatatatgattgttgatatgtgaaattgag 240  Q
    ||||| ||||||||||||||  ||||| ||||||||| | | ||||| ||||||||||||||| ||||||| |||||||||||||||| |||||||||      
46002670 gaatatgtgaattttgataa--ttatatgtatgattgattagttgtgaaattggtaatttgtttgatttatgtatatgattgttgatacgtgaaattgta 46002573  T
241 aattttattgatttcaagtgactttccgttaattttatctttagatgtttaaagaaattttattaattatgaggagtttgtgattttatggaattgataa 340  Q
    ||||||||||||   | |||||| |  ||| ||||| || | ||| ||||  |||||||||||||||| ||||| ||| |||||||| |||| |||||||    
46002572 aattttattgataaaaggtgactctttgttgattttgtcctcagaggttttgagaaattttattaatt-tgaggtgttggtgattttgtggagttgataa 46002474  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 12 - 115
Target Start/End: Complemental strand, 46002867 - 46002764
Alignment:
12 atgaaaatagtaggttatgatattgaatttgatatgcttcatgattcgatggatgagtgaagatatgaattattattaatagatataacaatttttgttt 111  Q
    ||||||||| |||||| ||||||||||||||||||||||| |||||| ||||||||||||| | || |||| ||||||||| |||||| |||| ||| ||    
46002867 atgaaaataataggttgtgatattgaatttgatatgcttcttgattcaatggatgagtgaaaagattaattgttattaataaatataagaattgttggtt 46002768  T
112 agta 115  Q
    ||||    
46002767 agta 46002764  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 13 - 72
Target Start/End: Original strand, 8311763 - 8311822
Alignment:
13 tgaaaatagtaggttatgatattgaatttgatatgcttcatgattcgatggatgagtgaa 72  Q
    |||||||| ||| ||||||| |||||||||| ||||||| |||||||||||||| |||||    
8311763 tgaaaataatagattatgatgttgaatttgacatgcttcttgattcgatggatgggtgaa 8311822  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 26 - 77
Target Start/End: Original strand, 9745169 - 9745220
Alignment:
26 ttatgatattgaatttgatatgcttcatgattcgatggatgagtgaagatat 77  Q
    ||||||| |||||||||||||||||| |||||| ||||||||||||| ||||    
9745169 ttatgatgttgaatttgatatgcttcttgattcaatggatgagtgaaaatat 9745220  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 12 - 72
Target Start/End: Complemental strand, 10530264 - 10530204
Alignment:
12 atgaaaatagtaggttatgatattgaatttgatatgcttcatgattcgatggatgagtgaa 72  Q
    ||||||||  ||| ||||||| |||||||||||||||||| |||||  |||||||||||||    
10530264 atgaaaatgatagattatgatgttgaatttgatatgcttcttgatttaatggatgagtgaa 10530204  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 12 - 72
Target Start/End: Original strand, 29587606 - 29587666
Alignment:
12 atgaaaatagtaggttatgatattgaatttgatatgcttcatgattcgatggatgagtgaa 72  Q
    ||||||||  ||| ||||||| |||||||||||||||||| |||||  |||||||||||||    
29587606 atgaaaatgatagattatgatgttgaatttgatatgcttcttgatttaatggatgagtgaa 29587666  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #8
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 409 - 462
Target Start/End: Complemental strand, 46002411 - 46002357
Alignment:
409 agcatagcatataatagtgtcataagtgttaaatgggg-gattcatatccatgtg 462  Q
    ||||| ||||||||||||||||||||||| |||||||| |||||| || ||||||    
46002411 agcattgcatataatagtgtcataagtgtcaaatggggcgattcacattcatgtg 46002357  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 55; Significance: 2e-22; HSPs: 4)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 14 - 120
Target Start/End: Complemental strand, 11650647 - 11650541
Alignment:
14 gaaaatagtaggttatgatattgaatttgatatgcttcatgattcgatggatgagtgaagatatgaattattattaatagatataacaatttttgtttag 113  Q
    ||||||| | |||| ||||||||||||||||||||||| |||||| || ||||||| |||| || |||| ||||||||| |||||| |||| ||||||||    
11650647 gaaaataattggttgtgatattgaatttgatatgcttcttgattcaattgatgagttaagacattaattgttattaataaatataagaattgttgtttag 11650548  T
114 taatttt 120  Q
    |||||||    
11650547 taatttt 11650541  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 22 - 89
Target Start/End: Complemental strand, 19544773 - 19544707
Alignment:
22 taggttatgatattgaatttgatatgcttcatgattcgatggatgagtgaagatatgaattattatta 89  Q
    ||||||||||| ||||||| |||||||||  |||||||||||||||||||| | ||  ||||||||||    
19544773 taggttatgatgttgaatt-gatatgcttattgattcgatggatgagtgaaaagatttattattatta 19544707  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 13 - 72
Target Start/End: Complemental strand, 52641454 - 52641395
Alignment:
13 tgaaaatagtaggttatgatattgaatttgatatgcttcatgattcgatggatgagtgaa 72  Q
    |||||||  ||| ||||||| |||||||||||||||||| ||| || |||||||||||||    
52641454 tgaaaatgatagattatgatgttgaatttgatatgcttcttgactcaatggatgagtgaa 52641395  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 26 - 72
Target Start/End: Original strand, 29453693 - 29453738
Alignment:
26 ttatgatattgaatttgatatgcttcatgattcgatggatgagtgaa 72  Q
    |||||| ||||||||||||||||||| |||||| |||||||||||||    
29453693 ttatgacattgaatttgatatgcttcttgattc-atggatgagtgaa 29453738  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 45; Significance: 2e-16; HSPs: 3)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 10 - 70
Target Start/End: Complemental strand, 24304471 - 24304411
Alignment:
10 agatgaaaatagtaggttatgatattgaatttgatatgcttcatgattcgatggatgagtg 70  Q
    ||||||||||| ||||||||||||||| ||||||||||||||||||||| || ||||||||    
24304471 agatgaaaataataggttatgatattggatttgatatgcttcatgattctatcgatgagtg 24304411  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 12 - 72
Target Start/End: Complemental strand, 51443649 - 51443589
Alignment:
12 atgaaaatagtaggttatgatattgaatttgatatgcttcatgattcgatggatgagtgaa 72  Q
    ||||||||  ||| ||||||| |||||||||||||||||| |||||  |||||||||||||    
51443649 atgaaaatgatagattatgatgttgaatttgatatgcttcttgatttaatggatgagtgaa 51443589  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 12 - 72
Target Start/End: Complemental strand, 31654698 - 31654638
Alignment:
12 atgaaaatagtaggttatgatattgaatttgatatgcttcatgattcgatggatgagtgaa 72  Q
    ||||||||  ||| ||||||| ||| |||||||||||||| |||||  |||||||||||||    
31654698 atgaaaatgatagattatgatgttggatttgatatgcttcttgatttaatggatgagtgaa 31654638  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 39; Significance: 0.0000000000007; HSPs: 3)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 13 - 67
Target Start/End: Original strand, 22403780 - 22403834
Alignment:
13 tgaaaatagtaggttatgatattgaatttgatatgcttcatgattcgatggatga 67  Q
    |||||||| ||| ||||||| |||||||||||||||||| |||||||||||||||    
22403780 tgaaaataatagattatgatgttgaatttgatatgcttcttgattcgatggatga 22403834  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 12 - 72
Target Start/End: Complemental strand, 27977274 - 27977214
Alignment:
12 atgaaaatagtaggttatgatattgaatttgatatgcttcatgattcgatggatgagtgaa 72  Q
    ||||||||  ||| ||||||| |||||||||||||||||| |||||  |||||||||||||    
27977274 atgaaaatgatagattatgatgttgaatttgatatgcttcttgatttaatggatgagtgaa 27977214  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 12 - 72
Target Start/End: Complemental strand, 28063802 - 28063742
Alignment:
12 atgaaaatagtaggttatgatattgaatttgatatgcttcatgattcgatggatgagtgaa 72  Q
    ||||||||  ||| ||||||| |||||||||||||||||| |||||  |||||||||||||    
28063802 atgaaaatgatagattatgatgttgaatttgatatgcttcttgatttaatggatgagtgaa 28063742  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 35; Significance: 0.0000000002; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 184 - 340
Target Start/End: Complemental strand, 18927046 - 18926891
Alignment:
184 ttgtggaattggtaatttgttgatttatatatatgattgttgatatgtgaaattgagaattttattgatttcaagtgactttccgttaattttat-cttt 282  Q
    ||||| |||||  ||||||||||||||||||   ||||||||||||||||||||  |||||| ||| |||| |||||||| | |||  ||||| |  |||    
18927046 ttgtgaaattgagaatttgttgatttatatag--gattgttgatatgtgaaatttggaatttgattaatttaaagtgactcttcgtggattttgtaattt 18926949  T
283 agatgtttaaagaaattttattaattatgaggagtttgtgattttatggaattgataa 340  Q
    |||| | | | ||||||||| ||||||||| |  || || ||||| ||||||||||||    
18926948 agatatcttatgaaattttagtaattatgaagttttagtaattttgtggaattgataa 18926891  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 10 - 51
Target Start/End: Complemental strand, 18927227 - 18927186
Alignment:
10 agatgaaaatagtaggttatgatattgaatttgatatgcttc 51  Q
    ||||||||||| ||||||||||  ||||||||||||||||||    
18927227 agatgaaaataataggttatgaagttgaatttgatatgcttc 18927186  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0022 (Bit Score: 33; Significance: 0.000000003; HSPs: 1)
Name: scaffold0022
Description:

Target: scaffold0022; HSP #1
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 12 - 72
Target Start/End: Original strand, 2054 - 2114
Alignment:
12 atgaaaatagtaggttatgatattgaatttgatatgcttcatgattcgatggatgagtgaa 72  Q
    ||||||| | ||| ||||||| |||||||||||||||||| |||||  |||||||||||||    
2054 atgaaaacaatagattatgatgttgaatttgatatgcttcttgatttaatggatgagtgaa 2114  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0259 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: scaffold0259
Description:

Target: scaffold0259; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 13 - 72
Target Start/End: Complemental strand, 2625 - 2566
Alignment:
13 tgaaaatagtaggttatgatattgaatttgatatgcttcatgattcgatggatgagtgaa 72  Q
    |||||||  ||||||||||| |||||||||| ||||||| |||||  |||||||||||||    
2625 tgaaaatgataggttatgatgttgaatttgacatgcttcttgatttaatggatgagtgaa 2566  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0016 (Bit Score: 29; Significance: 0.0000007; HSPs: 1)
Name: scaffold0016
Description:

Target: scaffold0016; HSP #1
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 12 - 72
Target Start/End: Original strand, 107887 - 107947
Alignment:
12 atgaaaatagtaggttatgatattgaatttgatatgcttcatgattcgatggatgagtgaa 72  Q
    ||||||||  ||| ||||||| |||||||||||||||| | |||||  |||||||||||||    
107887 atgaaaatgatagattatgatgttgaatttgatatgctccttgatttaatggatgagtgaa 107947  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 29; Significance: 0.0000007; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 12 - 72
Target Start/End: Complemental strand, 41943141 - 41943081
Alignment:
12 atgaaaatagtaggttatgatattgaatttgatatgcttcatgattcgatggatgagtgaa 72  Q
    ||||||||  ||| ||||| | |||||||||||||||||| |||||  |||||||||||||    
41943141 atgaaaatgatagattatgttgttgaatttgatatgcttcttgatttaatggatgagtgaa 41943081  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 126347 times since January 2019
Visitors: 1390