View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0095_high_8 (Length: 489)

Name: NF0095_high_8
Description: NF0095
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0095_high_8
NF0095_high_8
[»] chr3 (1 HSPs)
chr3 (30-485)||(780462-780905)


Alignment Details
Target: chr3 (Bit Score: 362; Significance: 0; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 362; E-Value: 0
Query Start/End: Original strand, 30 - 485
Target Start/End: Original strand, 780462 - 780905
Alignment:
30 ggaatttgcagacatggagcataccaatgaaagtggaaagtggaaggcgcgcggaaggagatgttgggggaaagaagagaagataaagaaaatttagtgt 129  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||    |||||||||||||||||||||||||||||||||||||||||||||||    
780462 ggaatttgcagacatggagcataccaatgaaagtggaaagtggaaggcg----gaaggagatgttgggggaaagaagagaagataaagaaaatttagtgt 780557  T
130 ggataatgtccacaacatttcgatctttaattaatctaataataagaaaaagttagttatgcaccatacaacacttgatttagttgtgcacatgtagcca 229  Q
    |||| ||||||||||||||||||||||||||    ||||||||||||||||||||    |||||||||||||| ||||||||||||||||||||||||||    
780558 ggatgatgtccacaacatttcgatctttaat----ctaataataagaaaaagtta----tgcaccatacaacatttgatttagttgtgcacatgtagcca 780649  T
230 cttgacaaatttggaggatcaatgttgcagtcgcatggaattagattttagcaacaaatgatcactatagcaagttctctcgatgaaacattgtagagag 329  Q
    |||||||| | ||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||| ||||    
780650 cttgacaattatggaggatcaatgttgcagtcgcatggaattagattttagcgacaaatgatca-tatagcaagttctctcgatgaaacattgtatagag 780748  T
330 aatcc-taaaaacaaagaagaaaaatgaccattaaatttcaataataggccatatcaatggctttatccctcaagtttcttgctgaatttgatgtttttc 428  Q
    || || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
780749 aaaccctaaaaacaaagaagaaaaatgaccattaaatttcaataataggccatatcaatggctttatccctcaagtttcttgctgaatttgatgtttttc 780848  T
429 atctgatgtttaaatttttcctcttcaacgtgtacttgagaatatttcttctcactc 485  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
780849 atctgatgtttaaatttttcctcttcaacgtgtacttgagaatatttcttctcactc 780905  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 126111 times since January 2019
Visitors: 1390