View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0095_high_9 (Length: 481)

Name: NF0095_high_9
Description: NF0095
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF0095_high_9
[»] chr3 (3 HSPs)
chr3 (221-324)||(49032768-49032871)
chr3 (405-466)||(49032624-49032685)
chr3 (405-473)||(41055024-41055095)
[»] chr8 (1 HSPs)
chr8 (405-473)||(42640418-42640489)
[»] chr7 (2 HSPs)
chr7 (86-120)||(43849846-43849880)
chr7 (259-300)||(30514632-30514673)

Alignment Details
Target: chr3 (Bit Score: 88; Significance: 4e-42; HSPs: 3)
Name: chr3

Target: chr3; HSP #1
Raw Score: 88; E-Value: 4e-42
Query Start/End: Original strand, 221 - 324
Target Start/End: Complemental strand, 49032871 - 49032768
221 gatgattgtttagttgtttggtagggatgaaagtgaagaggaaagaaagagatataaatagtaaatgacaaaaataccctaatataaaaatgatttatgt 320  Q
    |||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||| |||    
49032871 gatgattgtttagttgtttggtaggggtgaaagtgaagaggaaagaaagatatataaatagtaaatgacaaaaataccctaatataaaagtgatttgtgt 49032772  T
321 gtgt 324  Q
49032771 gtgt 49032768  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 405 - 466
Target Start/End: Complemental strand, 49032685 - 49032624
405 gtaaaggaaatacaaacattagattatttcaaataaaggaacacaaacgttaaaagaaatat 466  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||    
49032685 gtaaaggaaatacaaacattggattatttcaaataaaggaacacaaacgttaaaagaaatat 49032624  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 405 - 473
Target Start/End: Complemental strand, 41055095 - 41055024
405 gtaaaggaaatacaaacattagattatttcaaat-aaaggaacacaaacgttaaaa--gaaatattcatctc 473  Q
    ||||||||| || |||| |||||||||||||||| |||  ||||||||||||||||  |||||||| |||||    
41055095 gtaaaggaagtaaaaacgttagattatttcaaataaaaaaaacacaaacgttaaaaatgaaatatttatctc 41055024  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 33; Significance: 0.000000003; HSPs: 1)
Name: chr8

Target: chr8; HSP #1
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 405 - 473
Target Start/End: Original strand, 42640418 - 42640489
405 gtaaaggaaatacaaacattagattatttcaaat-aaaggaacacaaacgttaaaa--gaaatattcatctc 473  Q
    ||||||||| || |||| |||||||||||||||| |||| ||||||||||||||||  |||||||| |||||    
42640418 gtaaaggaagtaaaaacgttagattatttcaaataaaagaaacacaaacgttaaaaatgaaatatttatctc 42640489  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 31; Significance: 0.00000004; HSPs: 2)
Name: chr7

Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 86 - 120
Target Start/End: Original strand, 43849846 - 43849880
86 gaacaacgactcgaacaccattgactatgccaact 120  Q
    ||||||||||||||||||||||||||||| |||||    
43849846 gaacaacgactcgaacaccattgactatgtcaact 43849880  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 259 - 300
Target Start/End: Complemental strand, 30514673 - 30514632
259 aggaaagaaagagatataaatagtaaatgacaaaaataccct 300  Q
    |||||||||||| |||||  ||||||||||||||||||||||    
30514673 aggaaagaaagatatatatttagtaaatgacaaaaataccct 30514632  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 150604 times since January 2019
Visitors: 1522