View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0095_low_1 (Length: 980)

Name: NF0095_low_1
Description: NF0095
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0095_low_1
NF0095_low_1
[»] chr6 (4 HSPs)
chr6 (9-951)||(33701185-33702128)
chr6 (390-453)||(33714809-33714872)
chr6 (366-446)||(21136654-21136735)
chr6 (243-350)||(21311092-21311200)
[»] chr8 (2 HSPs)
chr8 (769-855)||(6094181-6094267)
chr8 (812-858)||(10920251-10920297)
[»] scaffold0076 (2 HSPs)
scaffold0076 (391-446)||(12757-12812)
scaffold0076 (266-347)||(12590-12672)
[»] scaffold0063 (1 HSPs)
scaffold0063 (769-855)||(5587-5673)
[»] chr1 (1 HSPs)
chr1 (801-855)||(21171328-21171382)
[»] scaffold0657 (1 HSPs)
scaffold0657 (810-855)||(1051-1096)
[»] scaffold0016 (1 HSPs)
scaffold0016 (429-466)||(47213-47250)
[»] chr5 (1 HSPs)
chr5 (778-855)||(17285804-17285881)
[»] chr4 (1 HSPs)
chr4 (810-855)||(26963698-26963743)
[»] chr2 (1 HSPs)
chr2 (716-745)||(19692575-19692604)


Alignment Details
Target: chr6 (Bit Score: 769; Significance: 0; HSPs: 4)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 769; E-Value: 0
Query Start/End: Original strand, 9 - 951
Target Start/End: Original strand, 33701185 - 33702128
Alignment:
9 gttttttctctttataccaagatgtatatcaaacattttcctttctattcaacaaaagaaaaaataaatttagaaactccattt----tagtagattgat 104  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    ||||||||||||    
33701185 gttttttctctttataccaagatgtatatcaaacattttcctttctattcaacaaaagaaaaaataaatttagaaactccatttattttagtagattgat 33701284  T
105 cttcaaaaataccaacatatgaaaatttaaaatttagtttttccaaatgtcggatactttcgagaaccaatgcaccaaaagttattacataccataacca 204  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||    
33701285 cttcaaaaataccaacatatgaaaatttaaaatttagtttttccaaatgtcggatactttcgagaaccaatgcaccaaaagttattacatactataacca 33701384  T
205 cttttataaactaagtggagatcgcataatatacatttcatttttgggtctaaacagttgcagcataagggtgttttataagtaaatcttcttattgttg 304  Q
    |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||| ||||    
33701385 cttttataaactaagtggagatagcataatatacatttcatttttgggtctaaacagttgcagcacaagggtcttttataagtaaatcttcttatcgttg 33701484  T
305 tttaagcactattgatgtgggactgttcagaccaaaatccagagtgtacttcttcatcctcctcatgtttctagtgttttatatgtcttggtgtttagaa 404  Q
    ||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||| |||||||||||||||||||||||||||||||||||||||    
33701485 tttaagcactattgatgtgggactgttcagaccaaaatccagagtatacttcttcgtcctgctcatgtttctagtgttttatatgtcttggtgtttagaa 33701584  T
405 tttctattctatagaattttgatcttgttaaattttggattaggatgggtttcgttgcatagattgtgactatagaaagagaaacgnnnnnnnnntatat 504  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||          ||||    
33701585 tttctattctatagaattttgatcttgttaaattttggattaggatgggtttcgttgcatagattgtgactatagaaagagaaacgaaaaaaaaaaatat 33701684  T
505 tgagaaagtctagtgttaaggaagatgaaaatgataaaaatgnnnnnnnagatgcacatgaaacaatttatataacttactacgtaatattatcatggtt 604  Q
    ||||||||||||||||||||||||||||||||||||||||||       |||||||||||||||| ||||||||||||||||||||||||||||||||||    
33701685 tgagaaagtctagtgttaaggaagatgaaaatgataaaaatg-ttttttagatgcacatgaaacagtttatataacttactacgtaatattatcatggtt 33701783  T
605 agtcaatcttaatacttaaactcatctgaaagatctgttaactctttattatgattcgtgaaatttaatcattggtcttgtacatatataacaatctcta 704  Q
    ||||||||  |||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||| || | |||| |||||||| ||| ||    
33701784 agtcaatc-gaatacttaaactcacctgaaagatttgttaactctttattatgattcgtgaaatttaatcattgctc-tctacacatataacagtcttta 33701881  T
705 tgcagtataaatatctcatttcatagtaaaacttttgactatgtgttgtaccaaataaaacttctgactatagatacttcaaaaataatgtcattttgtt 804  Q
    ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
33701882 tgcagtataaatatctcatttcatagtaaaacttttgactatgggttgtaccaaataaaacttctgactatagatacttcaaaaataatgtcattttgtt 33701981  T
805 caacagggtctcacgattaaatcatatttaatgtttcattaaacggactaattaaatccctcaagttaacagaacaagttacattagatagatttgctaa 904  Q
    |||| |  |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||    
33701982 caacggaatctcacgattaaatcatatttaatgtttcattaaacggactaattaaatccctcaagttaacagaacaagttacattagatagacttgctaa 33702081  T
905 taacctgatattatcatagcttgaacaattggaatacatgtcacatt 951  Q
    |||||||||||||||||||||||||||||||||||||||||||||||    
33702082 taacctgatattatcatagcttgaacaattggaatacatgtcacatt 33702128  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 36; E-Value: 0.00000000009
Query Start/End: Original strand, 390 - 453
Target Start/End: Original strand, 33714809 - 33714872
Alignment:
390 tcttggtgtttagaatttctattctatagaattttgatcttgttaaattttggattaggatggg 453  Q
    |||||||||| ||| |||||||||| ||||| |||||  |||||||||||| ||||||||||||    
33714809 tcttggtgttgagattttctattctttagaactttgaatttgttaaattttagattaggatggg 33714872  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 366 - 446
Target Start/End: Original strand, 21136654 - 21136735
Alignment:
366 ctcatgtttctagt-gttttatatgtcttggtgtttagaatttctattctatagaattttgatcttgttaaattttggatta 446  Q
    ||||||||||| || |||| |||||| |||||||| ||||||| ||||||  |||| |||||  ||||||||||||||||||    
21136654 ctcatgtttctggttgtttgatatgtattggtgttgagaatttatattcttcagaactttgaatttgttaaattttggatta 21136735  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 243 - 350
Target Start/End: Original strand, 21311092 - 21311200
Alignment:
243 catttttgggtctaaacagttgcagcataagggtgttttataagtaaatcttctt-attgttgtttaagcactattgatgtgggactgttcagaccaaaa 341  Q
    |||| |||||||||||| |||  |||| |||||  |||||||||||| |||||||  |||||| ||||| || ||  || |||||||||||| |||||||    
21311092 cattattgggtctaaactgttagagcacaagggccttttataagtaagtcttcttctttgttggttaagtaccatcaatatgggactgttcaaaccaaaa 21311191  T
342 tccagagtg 350  Q
    || ||||||    
21311192 tctagagtg 21311200  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 35; Significance: 0.0000000004; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 769 - 855
Target Start/End: Complemental strand, 6094267 - 6094181
Alignment:
769 tgactatagatacttcaaaaataatgtcattttgttcaacagggtctcacgattaaatcatatttaatgtttcattaaacggactaa 855  Q
    |||||| |||||||| ||||||| | || || |||| ||| ||||||||| ||||| | ||| |||||||| |||||||||||||||    
6094267 tgactacagatactttaaaaatagtttccttatgtttaacggggtctcacaattaagttatacttaatgttccattaaacggactaa 6094181  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 812 - 858
Target Start/End: Complemental strand, 10920297 - 10920251
Alignment:
812 gtctcacgattaaatcatatttaatgtttcattaaacggactaatta 858  Q
    ||||||||||||| ||||| |||||||| |||||||| |||||||||    
10920297 gtctcacgattaactcatacttaatgttccattaaacagactaatta 10920251  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0076 (Bit Score: 32; Significance: 0.00000002; HSPs: 2)
Name: scaffold0076
Description:

Target: scaffold0076; HSP #1
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 391 - 446
Target Start/End: Original strand, 12757 - 12812
Alignment:
391 cttggtgtttagaatttctattctatagaattttgatcttgttaaattttggatta 446  Q
    |||| |||| ||||||| |||||| ||||| ||||| |||||||||||||||||||    
12757 cttgatgttgagaatttgtattctttagaactttgaacttgttaaattttggatta 12812  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0076; HSP #2
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 266 - 347
Target Start/End: Original strand, 12590 - 12672
Alignment:
266 agcataagggtgttttataagtaaatcttcttattg-ttgtttaagcactattgatgtgggactgttcagaccaaaatccaga 347  Q
    |||| |||||| |||||||||||||||||| | ||| |||||||||||| ||  |||||||||| |||| |  ||||||||||    
12590 agcacaagggtcttttataagtaaatcttcctcttgattgtttaagcaccatccatgtgggactattcaaataaaaatccaga 12672  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0063 (Bit Score: 31; Significance: 0.00000009; HSPs: 1)
Name: scaffold0063
Description:

Target: scaffold0063; HSP #1
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 769 - 855
Target Start/End: Complemental strand, 5673 - 5587
Alignment:
769 tgactatagatacttcaaaaataatgtcattttgttcaacagggtctcacgattaaatcatatttaatgtttcattaaacggactaa 855  Q
    |||||| | |||||| || |||||| || || |||| ||| ||||||||| ||||| | ||| |||||||| |||||||||||||||    
5673 tgactacatatactttaagaataatttccttatgtttaacggggtctcacaattaagttatacttaatgttccattaaacggactaa 5587  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 31; Significance: 0.00000009; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 801 - 855
Target Start/End: Original strand, 21171328 - 21171382
Alignment:
801 tgttcaacagggtctcacgattaaatcatatttaatgtttcattaaacggactaa 855  Q
    |||||||| ||||||||| ||||| | |||||||||||| ||| |||||||||||    
21171328 tgttcaacggggtctcacaattaagttatatttaatgttccatgaaacggactaa 21171382  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0657 (Bit Score: 30; Significance: 0.0000004; HSPs: 1)
Name: scaffold0657
Description:

Target: scaffold0657; HSP #1
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 810 - 855
Target Start/End: Complemental strand, 1096 - 1051
Alignment:
810 gggtctcacgattaaatcatatttaatgtttcattaaacggactaa 855  Q
    ||||||||| ||||| | ||| ||||||||||||||||||||||||    
1096 gggtctcacaattaagttatacttaatgtttcattaaacggactaa 1051  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0016 (Bit Score: 30; Significance: 0.0000004; HSPs: 1)
Name: scaffold0016
Description:

Target: scaffold0016; HSP #1
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 429 - 466
Target Start/End: Complemental strand, 47250 - 47213
Alignment:
429 ttgttaaattttggattaggatgggtttcgttgcatag 466  Q
    |||||||||||||||||| ||||||||||||| |||||    
47250 ttgttaaattttggattaagatgggtttcgttacatag 47213  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 30; Significance: 0.0000004; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 778 - 855
Target Start/End: Original strand, 17285804 - 17285881
Alignment:
778 atacttcaaaaataatgtcattttgttcaacagggtctcacgattaaatcatatttaatgtttcattaaacggactaa 855  Q
    |||||| || ||||||||||||| ||| |  ||||| |||||||||| ||| | |||||||| |||||||| ||||||    
17285804 atactttaagaataatgtcatttagtttactagggtttcacgattaagtcacacttaatgttccattaaacagactaa 17285881  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 30; Significance: 0.0000004; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 810 - 855
Target Start/End: Complemental strand, 26963743 - 26963698
Alignment:
810 gggtctcacgattaaatcatatttaatgtttcattaaacggactaa 855  Q
    ||||||||| ||||| | |||||||||||| |||||||||||||||    
26963743 gggtctcacaattaagttatatttaatgttccattaaacggactaa 26963698  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 30; Significance: 0.0000004; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 716 - 745
Target Start/End: Original strand, 19692575 - 19692604
Alignment:
716 tatctcatttcatagtaaaacttttgacta 745  Q
    ||||||||||||||||||||||||||||||    
19692575 tatctcatttcatagtaaaacttttgacta 19692604  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 126570 times since January 2019
Visitors: 1391