View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0095_low_10 (Length: 505)

Name: NF0095_low_10
Description: NF0095
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0095_low_10
NF0095_low_10
[»] chr7 (4 HSPs)
chr7 (73-496)||(43070778-43071203)
chr7 (73-285)||(1262389-1262601)
chr7 (91-285)||(48849391-48849585)
chr7 (73-114)||(48849586-48849627)
[»] chr2 (5 HSPs)
chr2 (73-461)||(23348413-23348801)
chr2 (73-457)||(12741988-12742372)
chr2 (73-496)||(18354703-18355134)
chr2 (294-496)||(10328422-10328627)
chr2 (73-165)||(10328626-10328718)
[»] scaffold0596 (1 HSPs)
scaffold0596 (73-496)||(954-1378)
[»] chr3 (8 HSPs)
chr3 (73-461)||(19881544-19881932)
chr3 (73-496)||(53972682-53973107)
chr3 (73-312)||(37982652-37982891)
chr3 (304-462)||(37982939-37983097)
chr3 (73-285)||(31685377-31685575)
chr3 (29-84)||(43806781-43806836)
chr3 (218-263)||(17682201-17682246)
chr3 (218-263)||(19766443-19766488)
[»] chr5 (4 HSPs)
chr5 (73-457)||(9044102-9044486)
chr5 (73-457)||(7472922-7473310)
chr5 (73-457)||(30441983-30442368)
chr5 (341-423)||(40163917-40163996)
[»] chr8 (4 HSPs)
chr8 (73-286)||(14677630-14677843)
chr8 (73-278)||(31100488-31100693)
chr8 (73-278)||(5658071-5658261)
chr8 (80-214)||(33688978-33689112)
[»] scaffold0035 (1 HSPs)
scaffold0035 (73-286)||(35361-35574)
[»] chr4 (1 HSPs)
chr4 (73-286)||(29862969-29863182)
[»] scaffold0045 (1 HSPs)
scaffold0045 (73-286)||(11242-11455)
[»] chr6 (3 HSPs)
chr6 (73-278)||(33045062-33045252)
chr6 (81-219)||(22000988-22001126)
chr6 (73-286)||(10092793-10092985)


Alignment Details
Target: chr7 (Bit Score: 343; Significance: 0; HSPs: 4)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 343; E-Value: 0
Query Start/End: Original strand, 73 - 496
Target Start/End: Complemental strand, 43071203 - 43070778
Alignment:
73 ttatgtgttggaattcagattgttttaactcaaaaaattctcttcgccctttgagttgttcatcctccacctcactctcagacattcaaacaaaattctc 172  Q
    |||||||||||||||||||||| ||| |||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||    
43071203 ttatgtgttggaattcagattgcttttactcaaaaaaatctcttcgccctttgagttgttcatcttccacctcactctcagacattcaaacaaaattctc 43071104  T
173 tgccgttgccgctctctctgtcgccgcagctctctcctgtcgtcgcccttcaccaatgctctcgattctgacttcaccttcgacgttgtcgtctgcggca 272  Q
    |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||| |||||||||||||||||    
43071103 tgccgttgccgctctctccgtcgccgcagctctctcctgtcgtcgcccttcaccaatgctctcgattccgacatcaccttcgccgttgtcgtctgcggca 43071004  T
273 tcgtattagccaggtgtgttgaagatgctactatatatatcctaaatcgttgttcttgtaacttttccctaactttgttattccattatatttttggttt 372  Q
    |||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||    
43071003 tcgtatcagccaggtgtgttgaagatgctactatatatatcctaaatcgttgttcctgtaacttttccctaactttgttattccattacatttttggttt 43070904  T
373 gtttgtaagtgaattgatgatatttaaatagattttaccatcatgtattatgctattaataaattgattgatactttaaaatc--atgtgtannnnnnnn 470  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||  |||||||            
43070903 gtttgtaagtgaattgatgatatttaaatagattttaccatcatgtattatgctcttaataaattgattgatactttaaaatcatatgtgtatttttttt 43070804  T
471 caaacacaccaatatgtccattgatg 496  Q
    ||||||||||||||||||||||||||    
43070803 caaacacaccaatatgtccattgatg 43070778  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 161; E-Value: 1e-85
Query Start/End: Original strand, 73 - 285
Target Start/End: Original strand, 1262389 - 1262601
Alignment:
73 ttatgtgttggaattcagattgttttaactcaaaaaattctcttcgccctttgagttgttcatcctccacctcactctcagacattcaaacaaaattctc 172  Q
    ||||||||||||||||| |||| ||| |||| ||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||    
1262389 ttatgtgttggaattcatattgcttttactcgaaaaaatctcttcgccctttgagttgttcatcttccacctcactctcagacattcaaacaaaattctc 1262488  T
173 tgccgttgccgctctctctgtcgccgcagctctctcctgtcgtcgcccttcaccaatgctctcgattctgacttcaccttcgacgttgtcgtctgcggca 272  Q
    ||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||| ||||||||| |||||||    
1262489 tgccgttgccgctttctccgtcgccgcagctctctcctgtcgtcgcccttcaccaatgctctcgattccgacatcaccttcgccgttgtcgtatgcggca 1262588  T
273 tcgtattagccag 285  Q
    |||||| ||||||    
1262589 tcgtatcagccag 1262601  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 151; E-Value: 1e-79
Query Start/End: Original strand, 91 - 285
Target Start/End: Complemental strand, 48849585 - 48849391
Alignment:
91 attgttttaactcaaaaaattctcttcgccctttgagttgttcatcctccacctcactctcagacattcaaacaaaattctctgccgttgccgctctctc 190  Q
    |||| ||| |||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||    
48849585 attgcttttactcaaaaaaatctcttcgccctttgagttgttcatcttccacctcactctcagacattcaaacaaaattctctgccgttgccgctttctc 48849486  T
191 tgtcgccgcagctctctcctgtcgtcgcccttcaccaatgctctcgattctgacttcaccttcgacgttgtcgtctgcggcatcgtattagccag 285  Q
     ||||||||||||||||||| ||||||||||||||||||||||||||||| ||| ||||||||| ||||||||||||||||||||||| ||||||    
48849485 cgtcgccgcagctctctcctttcgtcgcccttcaccaatgctctcgattccgacatcaccttcgccgttgtcgtctgcggcatcgtatcagccag 48849391  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 73 - 114
Target Start/End: Complemental strand, 48849627 - 48849586
Alignment:
73 ttatgtgttggaattcagattgttttaactcaaaaaattctc 114  Q
    |||||||||||||||||||||| ||| |||||||||| ||||    
48849627 ttatgtgttggaattcagattgcttttactcaaaaaaatctc 48849586  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 341; Significance: 0; HSPs: 5)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 341; E-Value: 0
Query Start/End: Original strand, 73 - 461
Target Start/End: Complemental strand, 23348801 - 23348413
Alignment:
73 ttatgtgttggaattcagattgttttaactcaaaaaattctcttcgccctttgagttgttcatcctccacctcactctcagacattcaaacaaaattctc 172  Q
    |||||||||||||||||||||| ||| |||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||    
23348801 ttatgtgttggaattcagattgcttttactcaaaaaaatctcttcgccctttgagttgttcatcttccacctcactctcagacattcaaacaaaattctc 23348702  T
173 tgccgttgccgctctctctgtcgccgcagctctctcctgtcgtcgcccttcaccaatgctctcgattctgacttcaccttcgacgttgtcgtctgcggca 272  Q
    |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||| |||||||||||||||||    
23348701 tgccgttgccgctctctccgtcgccgcagctctctcctgtcgtcgcccttcaccaatgctctcgattccgacatcaccttcgccgttgtcgtctgcggca 23348602  T
273 tcgtattagccaggtgtgttgaagatgctactatatatatcctaaatcgttgttcttgtaacttttccctaactttgttattccattatatttttggttt 372  Q
    |||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||    
23348601 tcgtatcagccaggtgtgttgaagatgctactatatatatcctaaatcgttgttcctgtaacttttccctaactttgttattccattacatttttggttt 23348502  T
373 gtttgtaagtgaattgatgatatttaaatagattttaccatcatgtattatgctattaataaattgattgatactttaaaatcatgtgt 461  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||    
23348501 gtttgtaagtgaattgatgatatttaaatagattttaccatcatgtattatgctgttaataaattgattgatactttaaaatcatgtgt 23348413  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 329; E-Value: 0
Query Start/End: Original strand, 73 - 457
Target Start/End: Original strand, 12741988 - 12742372
Alignment:
73 ttatgtgttggaattcagattgttttaactcaaaaaattctcttcgccctttgagttgttcatcctccacctcactctcagacattcaaacaaaattctc 172  Q
    |||||||||||||||||||||| ||| |||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||    
12741988 ttatgtgttggaattcagattgcttttactcaaaaaaatctcttcgccctttgagttgttcatcttccacctcactctcagacattcaaacaaaattctc 12742087  T
173 tgccgttgccgctctctctgtcgccgcagctctctcctgtcgtcgcccttcaccaatgctctcgattctgacttcaccttcgacgttgtcgtctgcggca 272  Q
    |||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||| |||||||||||||||||    
12742088 tgccgttgccgctctctccgccgccgcagctctctcctgtcgtcgcccttcaccaatgctctcgattccgacatcaccttcgtcgttgtcgtctgcggca 12742187  T
273 tcgtattagccaggtgtgttgaagatgctactatatatatcctaaatcgttgttcttgtaacttttccctaactttgttattccattatatttttggttt 372  Q
    |||||| ||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||    
12742188 tcgtatcagcaaggtgtgttgaagatgctactatatatatcctaaatcgttgttcctgtaacttttccctaactttgttattccattacatttttggttt 12742287  T
373 gtttgtaagtgaattgatgatatttaaatagattttaccatcatgtattatgctattaataaattgattgatactttaaaatcat 457  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||    
12742288 gtttgtaagtgaattgatgatatttaaatagattttaccatcatgtattatgctgttaataaattgattgatactttaaaatcat 12742372  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 302; E-Value: 1e-170
Query Start/End: Original strand, 73 - 496
Target Start/End: Complemental strand, 18355134 - 18354703
Alignment:
73 ttatgtgttggaattcagattgttttaactcaaaaaattctcttcgccctttgagttgttcatcctccacctcactctcagacattcaaacaaaattctc 172  Q
    |||||||||||||||||||||| ||| |||||||||| |||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||    
18355134 ttatgtgttggaattcagattgcttttactcaaaaaaatctcttcgccctttgagttgttcatcttccatctcactctcagacattcaaacaaaattctc 18355035  T
173 tgccgttgccgctctctctgtcgccgcagctctctcctgtcgtcgcccttcaccaatgctctcgattctgacttcaccttcgacgttgtcgtctgcggca 272  Q
    |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||  ||||| |||||||||     
18355034 tgccgttgccgctctctccgtcgccgcagctctctcctgtcgtcgcccttcaccaatgctctcgattccgacatcaccttcgctgttgttgtctgcggcg 18354935  T
273 tcgtattagccaggtgtgttgaagatgctactatat------atatcctaaatcgttgttcttgtaacttttccctaactttgttattccattatatttt 366  Q
    |||||| || ||||||||||||||||||||||||||      ||||||||||||||||||| |||| ||||||||||||||||||||||||||| |||||    
18354934 tcgtatcagtcaggtgtgttgaagatgctactatatatatatatatcctaaatcgttgttcctgtagcttttccctaactttgttattccattacatttt 18354835  T
367 tggtttgtttgtaagtgaattgatgatatttaaatagattttaccatcatgtattatgctattaataaattgattgatactttaaaatc--atgtgtann 464  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||  |||||||      
18354834 tggtttgtttgtaagtgaattgatgatatttaaatagattttaccatcatgtattatgctcttaataaattgattgatactttaaaatcatatgtgtatt 18354735  T
465 nnnnnncaaacacaccaatatgtccattgatg 496  Q
          ||||||||||||||||||||||||||    
18354734 ttttttcaaacacaccaatatgtccattgatg 18354703  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 147; E-Value: 3e-77
Query Start/End: Original strand, 294 - 496
Target Start/End: Complemental strand, 10328627 - 10328422
Alignment:
294 aagatgctactatatatat--cctaaatcgttgttcttgtaacttttccctaactttgttattccattatatttttggtttgtttgtaagtgaattgatg 391  Q
    |||||||||||||||||||  ||||||||||||||| |||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||    
10328627 aagatgctactatatatatatcctaaatcgttgttcatgtatcttttccctaactttgttattccattacatttttggtttgtttgtaagtgaattgatg 10328528  T
392 atatttaaatagattttaccatcatgtattatgctattaataaattgattgatactttaaaatcatgtgta-nnnnnnnncaaacacaccaatatgtcca 490  Q
    ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||         ||||||||||||||||||||    
10328527 atatttaaatagattttaccatcatgtattatgctgttaataaattgattgatactttaaaatcatgtgtatttttttttcaaacacaccaatatgtcca 10328428  T
491 ttgatg 496  Q
    ||||||    
10328427 ttgatg 10328422  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 73; E-Value: 4e-33
Query Start/End: Original strand, 73 - 165
Target Start/End: Complemental strand, 10328718 - 10328626
Alignment:
73 ttatgtgttggaattcagattgttttaactcaaaaaattctcttcgccctttgagttgttcatcctccacctcactctcagacattcaaacaa 165  Q
    ||||||||||||||| |||||| ||| |||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||    
10328718 ttatgtgttggaatttagattgcttttactcaaaaaaatctcttcgccctttgagttgttcatcttccacctcactctcagacattcaaacaa 10328626  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0596 (Bit Score: 325; Significance: 0; HSPs: 1)
Name: scaffold0596
Description:

Target: scaffold0596; HSP #1
Raw Score: 325; E-Value: 0
Query Start/End: Original strand, 73 - 496
Target Start/End: Original strand, 954 - 1378
Alignment:
73 ttatgtgttggaattcagattgttttaactcaaaaaattctcttcgccctttgagttgttcatcctccacctcactctcagacattcaaacaaaattctc 172  Q
    ||||||||||||||||| |||| ||| |||||||||| ||||||| |||||||||||||||||| ||||||||||||||||||||| |||||||||||||    
954 ttatgtgttggaattcaaattgcttttactcaaaaaaatctcttctccctttgagttgttcatcttccacctcactctcagacatttaaacaaaattctc 1053  T
173 tgccgttgccgctctctctgtcgccgcagctctctcctgtcgtcgcccttcaccaatgctctcgattctgacttcaccttcgacgttgtcgtctgcggca 272  Q
    |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||| |||| |||||||||||||||||    
1054 tgccgttgccgctctctccgtcgccgcagctctctcctgtcgtcgcccttcaccaatgctctcgattccgacatcactttcgccgttgtcgtctgcggca 1153  T
273 tcgtattagccaggtgtgttgaagatgctactatatatatcctaaatcgttgttcttgtaacttttccctaactttgttattccattatatttttggttt 372  Q
    |||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||    
1154 tcgtatcagccaggtgtgttgaagatgctactatatatatcctaaatcgttgttcctgtaacttttccctaactttgttattccattacatttttggttt 1253  T
373 gtttgtaagtgaattgatgatatttaaatagattttaccatcatgtattatgctattaataaattgattgatactttaaaatcatgtgta-nnnnnnnnc 471  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||         |    
1254 gtttgtaagtgaattgatgatatttaaatagattttaccatcatgtattatgctgttaataaattgattgatattttaaaatcatgtgtatttttttttc 1353  T
472 aaacacaccaatatgtccattgatg 496  Q
    |||||||||||||||||||||||||    
1354 aaacacaccaatatgtccattgatg 1378  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 325; Significance: 0; HSPs: 8)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 325; E-Value: 0
Query Start/End: Original strand, 73 - 461
Target Start/End: Complemental strand, 19881932 - 19881544
Alignment:
73 ttatgtgttggaattcagattgttttaactcaaaaaattctcttcgccctttgagttgttcatcctccacctcactctcagacattcaaacaaaattctc 172  Q
    |||||||||||||||||||||| ||| |||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||    
19881932 ttatgtgttggaattcagattgcttttactcaaaaaaatctcttcgccctttgagttgttcatcttccacctcactctcagacattcaaacaaaattctc 19881833  T
173 tgccgttgccgctctctctgtcgccgcagctctctcctgtcgtcgcccttcaccaatgctctcgattctgacttcaccttcgacgttgtcgtctgcggca 272  Q
    || ||||||||||||||| ||| |||||||||||||||||| || ||||||||||||||||||||||| ||| ||||||||| |||||||||||||||||    
19881832 tgtcgttgccgctctctccgtcaccgcagctctctcctgtcctcacccttcaccaatgctctcgattccgacatcaccttcgccgttgtcgtctgcggca 19881733  T
273 tcgtattagccaggtgtgttgaagatgctactatatatatcctaaatcgttgttcttgtaacttttccctaactttgttattccattatatttttggttt 372  Q
    |||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||    
19881732 tcgtatcagccaggtgtgttgaagatgctactatatatatcctaaatcgttgttcctgtaacttttccctaactttgttattccattacatttttggttt 19881633  T
373 gtttgtaagtgaattgatgatatttaaatagattttaccatcatgtattatgctattaataaattgattgatactttaaaatcatgtgt 461  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||    
19881632 gtttgtaagtgaattgatgatatttaaatagattttaccatcatgtattatgctgttaataaattgattgatactttaaaatcatgtgt 19881544  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 323; E-Value: 0
Query Start/End: Original strand, 73 - 496
Target Start/End: Complemental strand, 53973107 - 53972682
Alignment:
73 ttatgtgttggaattcagattgttttaactcaaaaaattctcttcgccctttgagttgttcatcctccacctcactctcagacattcaaacaaaattctc 172  Q
    |||||||||||||||||||||| ||| |||||||||| ||||||| |||||||||||||||||| ||||||||||||||||||||| |||||||||||||    
53973107 ttatgtgttggaattcagattgcttttactcaaaaaaatctcttctccctttgagttgttcatcttccacctcactctcagacatttaaacaaaattctc 53973008  T
173 tgccgttgccgctctctctgtcgccgcagctctctcctgtcgtcgcccttcaccaatgctctcgattctgacttcaccttcgacgttgtcgtctgcggca 272  Q
    || ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||| |||| |||||||||||||||||    
53973007 tgtcgttgccgctctctccgtcgccgcagctctctcctgtcgtcgcccttcaccaatgctctcgattccgacatcactttcgtcgttgtcgtctgcggca 53972908  T
273 tcgtattagccaggtgtgttgaagatgctactatatatatcctaaatcgttgttcttgtaacttttccctaactttgttattccattatatttttggttt 372  Q
    |||||| ||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||    
53972907 tcgtatcagccaagtgtgttgaagatgctactatatatatcctaaatcgttgttcctgtaacttttccctaactttgttattccattacatttttggttt 53972808  T
373 gtttgtaagtgaattgatgatatttaaatagattttaccatcatgtattatgctattaataaattgattgatactttaaaatcatgtgta--nnnnnnnn 470  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||              
53972807 gtttgtaagtgaattgatgatatttaaatagattttaccatcatgtattatgctgttaataaattgattgatactttaaaatcatgtgtatttttttttt 53972708  T
471 caaacacaccaatatgtccattgatg 496  Q
    ||||||||||||||||||||||||||    
53972707 caaacacaccaatatgtccattgatg 53972682  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 184; E-Value: 2e-99
Query Start/End: Original strand, 73 - 312
Target Start/End: Original strand, 37982652 - 37982891
Alignment:
73 ttatgtgttggaattcagattgttttaactcaaaaaattctcttcgccctttgagttgttcatcctccacctcactctcagacattcaaacaaaattctc 172  Q
    |||||| ||||||||||||||| ||| |||||||||| |||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||    
37982652 ttatgttttggaattcagattgcttttactcaaaaaaatctcttcgccctctgagttgttcatcttccacctcactctcagacattcaaacaaaattctc 37982751  T
173 tgccgttgccgctctctctgtcgccgcagctctctcctgtcgtcgcccttcaccaatgctctcgattctgacttcaccttcgacgttgtcgtctgcggca 272  Q
    || ||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||| ||| ||||||||| |||||||||||||||||    
37982752 tgtcgttgccgctctctccgtcgccgcagctctctcctatcgtcgcccttcaccaatgctctcgattccgacatcaccttcgtcgttgtcgtctgcggca 37982851  T
273 tcgtattagccaggtgtgttgaagatgctactatatatat 312  Q
    |||||| ||||||||||||||||||||||| |||||||||    
37982852 tcgtatcagccaggtgtgttgaagatgctaatatatatat 37982891  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 147; E-Value: 3e-77
Query Start/End: Original strand, 304 - 462
Target Start/End: Original strand, 37982939 - 37983097
Alignment:
304 tatatatatcctaaatcgttgttcttgtaacttttccctaactttgttattccattatatttttggtttgtttgtaagtgaattgatgatatttaaatag 403  Q
    |||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
37982939 tatatatatcctaaatcgttgttcctgtaacttttccctaactttgttattccattacatttttggtttgtttgtaagtgaattgatgatatttaaatag 37983038  T
404 attttaccatcatgtattatgctattaataaattgattgatactttaaaatcatgtgta 462  Q
    ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||    
37983039 attttaccatcatgtattatgctgttaataaattgattgatactttaaaatcatgtgta 37983097  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 104; E-Value: 1e-51
Query Start/End: Original strand, 73 - 285
Target Start/End: Original strand, 31685377 - 31685575
Alignment:
73 ttatgtgttggaattcagattgttttaactcaaaaaat-tctcttcgccctttgagttgttcatcctccacctcactctcagacattcaaacaaaattct 171  Q
    ||||||||||||||||| |||| ||| ||||||||||  |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |    
31685377 ttatgtgttggaattcaaattgcttttactcaaaaaaaatctcttcgccctttgagttgttcatcttccacctcactctcagacattcaaacaaaattat 31685476  T
172 ctgccgttgccgctctctctgtcgccgcagctctctcctgtcgtcgcccttcaccaatgctctcgattctgacttcaccttcgacgttgtcgtctgcggc 271  Q
     |||||||               |||||||||||||||||||||||||||||||||||| | ||||||| ||| ||||||||| ||||||||||||||||    
31685477 atgccgtt---------------gccgcagctctctcctgtcgtcgcccttcaccaatgatatcgattccgacatcaccttcgccgttgtcgtctgcggc 31685561  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 29 - 84
Target Start/End: Original strand, 43806781 - 43806836
Alignment:
29 agatgtgacgcagaattgcttgttttcttcattggtatgatatattatgtgttgga 84  Q
    |||||||||||||||||||||||||||||||||||||||||||| ||||| |||||    
43806781 agatgtgacgcagaattgcttgttttcttcattggtatgatataatatgttttgga 43806836  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 218 - 263
Target Start/End: Original strand, 17682201 - 17682246
Alignment:
218 cccttcaccaatgctctcgattctgacttcaccttcgacgttgtcg 263  Q
    ||||||||||||||||||||||| ||| ||||||| | ||||||||    
17682201 cccttcaccaatgctctcgattccgacatcacctttgccgttgtcg 17682246  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 218 - 263
Target Start/End: Original strand, 19766443 - 19766488
Alignment:
218 cccttcaccaatgctctcgattctgacttcaccttcgacgttgtcg 263  Q
    ||||||||||||||||| ||||| ||| ||||||||| ||||||||    
19766443 cccttcaccaatgctctagattccgacatcaccttcgccgttgtcg 19766488  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 321; Significance: 0; HSPs: 4)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 321; E-Value: 0
Query Start/End: Original strand, 73 - 457
Target Start/End: Original strand, 9044102 - 9044486
Alignment:
73 ttatgtgttggaattcagattgttttaactcaaaaaattctcttcgccctttgagttgttcatcctccacctcactctcagacattcaaacaaaattctc 172  Q
    |||||||||||||||||||||| ||| |||||||||| | |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||    
9044102 ttatgtgttggaattcagattgcttttactcaaaaaaatttcttcgccctttgagttgttcatcttccacctcactctcagacattcaaacaaaattctc 9044201  T
173 tgccgttgccgctctctctgtcgccgcagctctctcctgtcgtcgcccttcaccaatgctctcgattctgacttcaccttcgacgttgtcgtctgcggca 272  Q
    |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||  ||| ||||||||| ||||||||||||| |||    
9044202 tgccgttgccgctctctccgtcgccgcagctctctcctgtcgtcgcccttcaccaatgctctcgatttcgacatcaccttcgtcgttgtcgtctgcagca 9044301  T
273 tcgtattagccaggtgtgttgaagatgctactatatatatcctaaatcgttgttcttgtaacttttccctaactttgttattccattatatttttggttt 372  Q
    |||||| ||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||    
9044302 tcgtatcagccaagtgtgttgaagatgctactatatatatcctaaatcgttgttcctgtaacttttccctaactttgttattccattacatttttggttt 9044401  T
373 gtttgtaagtgaattgatgatatttaaatagattttaccatcatgtattatgctattaataaattgattgatactttaaaatcat 457  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||    
9044402 gtttgtaagtgaattgatgatatttaaatagattttaccatcatgtattatgctgttaataaattgattgatactttaaaatcat 9044486  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 316; E-Value: 1e-178
Query Start/End: Original strand, 73 - 457
Target Start/End: Complemental strand, 7473310 - 7472922
Alignment:
73 ttatgtgttggaattcagattgttttaactcaaaaaattctcttcgccctttgagttgttcatcctccacctcactctcagacattcaaacaaaattctc 172  Q
    ||||||||||||||| |||||| ||| |||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||    
7473310 ttatgtgttggaatttagattgcttttactcaaaaaaatctcttcgccctttgagttgttcatcttccacctcactctcagacattcaaacaaaattctc 7473211  T
173 tgccgttgccgctctctctgtcgccgcagctctctcctgtcgtcgcccttcaccaatgctctcgattctgacttcaccttcgacgttgtcgtctgcggca 272  Q
    |||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||| |||||||||||||||||    
7473210 tgccgttgtcgctctctccgtcgccgcagctctctcctgtcgtcgcccttcaccaatgctctcgattccgacatcaccttcgccgttgtcgtctgcggca 7473111  T
273 tcgtattagccaggtgtgttgaagatgctactatat----atatcctaaatcgttgttcttgtaacttttccctaactttgttattccattatatttttg 368  Q
    |||||| |||||||||||||||||||||||||||||    ||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||    
7473110 tcgtatcagccaggtgtgttgaagatgctactatatatatatatcctaaatcgttgttcctgtaacttttccctaactttgttattccattacatttttg 7473011  T
369 gtttgtttgtaagtgaattgatgatatttaaatagattttaccatcatgtattatgctattaataaattgattgatactttaaaatcat 457  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||    
7473010 gtttgtttgtaagtgaattgatgatatttaaatagattttaccatcatgtattatgctgttaataaattgattgatactttaaaatcat 7472922  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 306; E-Value: 1e-172
Query Start/End: Original strand, 73 - 457
Target Start/End: Complemental strand, 30442368 - 30441983
Alignment:
73 ttatgtgttggaattcagattgttttaactcaaaaaat-tctcttcgccctttgagttgttcatcctccacctcactctcagacattcaaacaaaattct 171  Q
    |||||||||||||||||||||| ||| ||||||||||  |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||    
30442368 ttatgtgttggaattcagattgcttttactcaaaaaaaatctcttcgccctttgagttgttcatcttccacctcactctcagacattcaaacaaaattct 30442269  T
172 ctgccgttgccgctctctctgtcgccgcagctctctcctgtcgtcgcccttcaccaatgctctcgattctgacttcaccttcgacgttgtcgtctgcggc 271  Q
    ||| ||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||| | ||||||||||||||||    
30442268 ctgtcgttgccgctctctccgttgccgcagctctctcctgtcgtcgcccttcaccaatgctctcgattccgacatcaccttggccgttgtcgtctgcggc 30442169  T
272 atcgtattagccaggtgtgttgaagatgctactatatatatcctaaatcgttgttcttgtaacttttccctaactttgttattccattatatttttggtt 371  Q
    ||||||| |||||  ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||    
30442168 atcgtatcagccatatgtgttgaagatgctactatatatatcctaaatcgttgttcctgtaacttttccctaactttgttattccattacatttttggtt 30442069  T
372 tgtttgtaagtgaattgatgatatttaaatagattttaccatcatgtattatgctattaataaattgattgatactttaaaatcat 457  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||    
30442068 tgtttgtaagtgaattgatgatatttaaatagattttaccatcatgtattatgttgttaataaattgattgatactttaaaatcat 30441983  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 341 - 423
Target Start/End: Original strand, 40163917 - 40163996
Alignment:
341 ctaactttgttattccattatatttttggtttgtttgtaagtgaattgatgatatttaaatagattttaccatcatgtattat 423  Q
    ||||||||||||||||||||||| ||| ||||||||| | ||||||   ||||||||| ||||||||||| || |||||||||    
40163917 ctaactttgttattccattatatatttagtttgtttggatgtgaat---tgatatttacatagattttacaattatgtattat 40163996  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 150; Significance: 4e-79; HSPs: 4)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 150; E-Value: 4e-79
Query Start/End: Original strand, 73 - 286
Target Start/End: Complemental strand, 14677843 - 14677630
Alignment:
73 ttatgtgttggaattcagattgttttaactcaaaaaattctcttcgccctttgagttgttcatcctccacctcactctcagacattcaaacaaaattctc 172  Q
    |||||||||| ||||||||||| ||| |||||||||| ||||||  |||||||||||||||||| ||||||||||||||||||||||||||||||| |||    
14677843 ttatgtgttgaaattcagattgcttttactcaaaaaaatctctttcccctttgagttgttcatcttccacctcactctcagacattcaaacaaaatcctc 14677744  T
173 tgccgttgccgctctctctgtcgccgcagctctctcctgtcgtcgcccttcaccaatgctctcgattctgacttcaccttcgacgttgtcgtctgcggca 272  Q
    |||||||||||||||||| ||||||||||||||||||| ||||| ||||||||||||||||||||||| ||| ||||||||| ||||||||||||| |||    
14677743 tgccgttgccgctctctccgtcgccgcagctctctcctatcgtcacccttcaccaatgctctcgattccgacatcaccttcgccgttgtcgtctgcagca 14677644  T
273 tcgtattagccagg 286  Q
    |||||| |||||||    
14677643 tcgtatcagccagg 14677630  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 146; E-Value: 1e-76
Query Start/End: Original strand, 73 - 278
Target Start/End: Complemental strand, 31100693 - 31100488
Alignment:
73 ttatgtgttggaattcagattgttttaactcaaaaaattctcttcgccctttgagttgttcatcctccacctcactctcagacattcaaacaaaattctc 172  Q
    |||||||||||||||||||||| ||| |||||||||| ||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||     
31100693 ttatgtgttggaattcagattgcttttactcaaaaaaatctcttccccctttgagttgttcatcttccacctcactctcagacattcaaacaaaattctt 31100594  T
173 tgccgttgccgctctctctgtcgccgcagctctctcctgtcgtcgcccttcaccaatgctctcgattctgacttcaccttcgacgttgtcgtctgcggca 272  Q
    |||||| ||| ||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||  || ||||||||| |||||||||||| ||||    
31100593 tgccgtcgccactctctccgtcgccgcaactctctcctgtcgtcgcccttcaccaatgctctcgattccaacatcaccttcgccgttgtcgtctgtggca 31100494  T
273 tcgtat 278  Q
    ||||||    
31100493 tcgtat 31100488  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 108; E-Value: 5e-54
Query Start/End: Original strand, 73 - 278
Target Start/End: Original strand, 5658071 - 5658261
Alignment:
73 ttatgtgttggaattcagattgttttaactcaaaaaattctcttcgccctttgagttgttcatcctccacctcactctcagacattcaaacaaaattctc 172  Q
    |||||||||||||||||||||| ||| |||||||||| ||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||     
5658071 ttatgtgttggaattcagattgcttttactcaaaaaaatctcttccccctttgagttgttcatcttccacctcactctcagacattcaaacaaaattctt 5658170  T
173 tgccgttgccgctctctctgtcgccgcagctctctcctgtcgtcgcccttcaccaatgctctcgattctgacttcaccttcgacgttgtcgtctgcggca 272  Q
    ||||               ||||||||||||||||||||||||||||||||||||||||||| |||||  || ||||||||| |||||||||||| ||||    
5658171 tgcc---------------gtcgccgcagctctctcctgtcgtcgcccttcaccaatgctcttgattccaacatcaccttcgccgttgtcgtctgtggca 5658255  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 76; E-Value: 6e-35
Query Start/End: Original strand, 80 - 214
Target Start/End: Complemental strand, 33689112 - 33688978
Alignment:
80 ttggaattcagattgttttaactcaaaaaattctcttcgccctttgagttgttcatcctccacctcactctcagacattcaaacaa-aattctctgccgt 178  Q
    ||||||||||||||| ||| |||||||||| ||||||| |||||||||||||||||| ||||||||||||| |||||||||||||| | |||||| || |    
33689112 ttggaattcagattgcttttactcaaaaaaatctcttc-ccctttgagttgttcatcttccacctcactcttagacattcaaacaagacttctctcccat 33689014  T
179 tgccgctctctctgtcgccgcagctctctcctgtcg 214  Q
     ||||||||||| ||||||||||||||||| |||||    
33689013 cgccgctctctccgtcgccgcagctctctcatgtcg 33688978  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0035 (Bit Score: 142; Significance: 3e-74; HSPs: 1)
Name: scaffold0035
Description:

Target: scaffold0035; HSP #1
Raw Score: 142; E-Value: 3e-74
Query Start/End: Original strand, 73 - 286
Target Start/End: Original strand, 35361 - 35574
Alignment:
73 ttatgtgttggaattcagattgttttaactcaaaaaattctcttcgccctttgagttgttcatcctccacctcactctcagacattcaaacaaaattctc 172  Q
    ||||| |||||||||||||||| ||| |||||||||| ||  ||  |||||||||||||||||| |||||||||||||||||||||||||||||||||||    
35361 ttatgagttggaattcagattgcttttactcaaaaaaatcgttttcccctttgagttgttcatcttccacctcactctcagacattcaaacaaaattctc 35460  T
173 tgccgttgccgctctctctgtcgccgcagctctctcctgtcgtcgcccttcaccaatgctctcgattctgacttcaccttcgacgttgtcgtctgcggca 272  Q
    ||||||||| |||||||| |||||||||||||||||||||||||||| || ||| ||||||||||||||||| ||||||||| ||||||||| |||||||    
35461 tgccgttgctgctctctccgtcgccgcagctctctcctgtcgtcgcctttgaccgatgctctcgattctgacatcaccttcgccgttgtcgtttgcggca 35560  T
273 tcgtattagccagg 286  Q
    |||||| |||||||    
35561 tcgtatcagccagg 35574  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 142; Significance: 3e-74; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 142; E-Value: 3e-74
Query Start/End: Original strand, 73 - 286
Target Start/End: Complemental strand, 29863182 - 29862969
Alignment:
73 ttatgtgttggaattcagattgttttaactcaaaaaattctcttcgccctttgagttgttcatcctccacctcactctcagacattcaaacaaaattctc 172  Q
    ||||||||| |||||||||||| ||| |||||||||| ||||||  |||||||||||||||||| |||||||||||||||||||||||||||||||||||    
29863182 ttatgtgttagaattcagattgcttttactcaaaaaaatctctttcccctttgagttgttcatcttccacctcactctcagacattcaaacaaaattctc 29863083  T
173 tgccgttgccgctctctctgtcgccgcagctctctcctgtcgtcgcccttcaccaatgctctcgattctgacttcaccttcgacgttgtcgtctgcggca 272  Q
    || || |||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||| ||| |||| || | ||||||| |||||||||    
29863082 tgtcgctgccgctctctccgtcgccgcagctctctcctgtcgtcgcccttcaccgatgctctcgattccgacatcacttttgccgttgtcatctgcggca 29862983  T
273 tcgtattagccagg 286  Q
    |||||| |||||||    
29862982 tcgtatcagccagg 29862969  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0045 (Bit Score: 126; Significance: 9e-65; HSPs: 1)
Name: scaffold0045
Description:

Target: scaffold0045; HSP #1
Raw Score: 126; E-Value: 9e-65
Query Start/End: Original strand, 73 - 286
Target Start/End: Complemental strand, 11455 - 11242
Alignment:
73 ttatgtgttggaattcagattgttttaactcaaaaaattctcttcgccctttgagttgttcatcctccacctcactctcagacattcaaacaaaattctc 172  Q
    |||||||||||||||||||||| ||| ||||||| || || |||| |||||||||||||||||| |||||||||||| |||||||||||||||||||||     
11455 ttatgtgttggaattcagattgcttttactcaaacaaatcccttccccctttgagttgttcatcttccacctcactcccagacattcaaacaaaattctt 11356  T
173 tgccgttgccgctctctctgtcgccgcagctctctcctgtcgtcgcccttcaccaatgctctcgattctgacttcaccttcgacgttgtcgtctgcggca 272  Q
    ||  ||  |||||||||| ||||||||||||||||| |||||||||||||||||||||||||||| || ||| ||||||||| |||||||||||||||||    
11355 tgttgtcaccgctctctccgtcgccgcagctctctcttgtcgtcgcccttcaccaatgctctcgaatccgacatcaccttcgccgttgtcgtctgcggca 11256  T
273 tcgtattagccagg 286  Q
    | | || |||||||    
11255 ttgcatcagccagg 11242  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 108; Significance: 5e-54; HSPs: 3)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 108; E-Value: 5e-54
Query Start/End: Original strand, 73 - 278
Target Start/End: Complemental strand, 33045252 - 33045062
Alignment:
73 ttatgtgttggaattcagattgttttaactcaaaaaattctcttcgccctttgagttgttcatcctccacctcactctcagacattcaaacaaaattctc 172  Q
    |||||||||||||||||||||| ||| |||||||||| ||||||| |||||||||||||||||| || |||||||||||||||||||||||||||||||     
33045252 ttatgtgttggaattcagattgcttttactcaaaaaaatctcttccccctttgagttgttcatcttcaacctcactctcagacattcaaacaaaattctt 33045153  T
173 tgccgttgccgctctctctgtcgccgcagctctctcctgtcgtcgcccttcaccaatgctctcgattctgacttcaccttcgacgttgtcgtctgcggca 272  Q
    || |               |||||||||||||||||||||||||||||||||||||||||||||||||  || ||||||||| |||||||||||||||||    
33045152 tgtc---------------gtcgccgcagctctctcctgtcgtcgcccttcaccaatgctctcgattccaacatcaccttcgtcgttgtcgtctgcggca 33045068  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 99; E-Value: 1e-48
Query Start/End: Original strand, 81 - 219
Target Start/End: Complemental strand, 22001126 - 22000988
Alignment:
81 tggaattcagattgttttaactcaaaaaattctcttcgccctttgagttgttcatcctccacctcactctcagacattcaaacaaaattctctgccgttg 180  Q
    ||||||| | |||| ||| |||||||||| ||||||| |||||||||||||||||| ||||||||||| ||||||||||||||||||||||||| |||||    
22001126 tggaatttatattgcttttactcaaaaaaatctcttccccctttgagttgttcatcttccacctcactttcagacattcaaacaaaattctctgtcgttg 22001027  T
181 ccgctctctctgtcgccgcagctctctcctgtcgtcgcc 219  Q
    |||||||||| ||||||||||||||||||||||||||||    
22001026 ccgctctctccgtcgccgcagctctctcctgtcgtcgcc 22000988  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 89; E-Value: 1e-42
Query Start/End: Original strand, 73 - 286
Target Start/End: Original strand, 10092793 - 10092985
Alignment:
73 ttatgtgttggaattcagattgttttaactcaaaaaattctcttcgccctttgagttgttcatcctccacctcactctcagacattcaaacaaaattctc 172  Q
    ||||||||||||||||| |||| ||| |||||||||| |||||||  ||||| ||||||||||| |||||||||||||||||||||||||||||||||||    
10092793 ttatgtgttggaattcaaattgcttttactcaaaaaaatctcttc--cctttaagttgttcatcttccacctcactctcagacattcaaacaaaattctc 10092890  T
173 tgccgttgccgctctctctgtcgccgcagctctctcctgtcgtcgcccttcaccaatgctctcgattctgacttcaccttcgacgttgtcgtctgcggca 272  Q
    |  ||| ||||||||||                   |||||||||||||||||||||||||||||||| ||| ||||||||| |||||||||||||||||    
10092891 taacgtcgccgctctct-------------------ctgtcgtcgcccttcaccaatgctctcgattccgacatcaccttcgtcgttgtcgtctgcggca 10092971  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 150598 times since January 2019
Visitors: 1522