View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0095_low_11 (Length: 502)

Name: NF0095_low_11
Description: NF0095
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0095_low_11
NF0095_low_11
[»] chr4 (51 HSPs)
chr4 (92-502)||(50742617-50743027)
chr4 (152-329)||(2996510-2996689)
chr4 (140-255)||(8422867-8422982)
chr4 (148-324)||(1137645-1137823)
chr4 (198-329)||(7693965-7694095)
chr4 (196-315)||(28300267-28300386)
chr4 (196-321)||(50681050-50681176)
chr4 (161-255)||(17884014-17884110)
chr4 (147-284)||(6466045-6466184)
chr4 (161-302)||(20936210-20936353)
chr4 (138-249)||(3891500-3891611)
chr4 (227-324)||(17751106-17751200)
chr4 (140-256)||(18630605-18630723)
chr4 (220-323)||(21043195-21043298)
chr4 (286-329)||(22471347-22471390)
chr4 (220-321)||(1706629-1706731)
chr4 (288-330)||(4071953-4071995)
chr4 (160-267)||(10192229-10192337)
chr4 (214-284)||(11264302-11264372)
chr4 (276-329)||(3549509-3549562)
chr4 (219-324)||(4798525-4798630)
chr4 (131-329)||(21157684-21157884)
chr4 (139-196)||(51555956-51556013)
chr4 (214-305)||(17822842-17822934)
chr4 (219-250)||(7730630-7730661)
chr4 (219-250)||(11262796-11262827)
chr4 (227-329)||(36577496-36577599)
chr4 (220-255)||(39063675-39063710)
chr4 (216-255)||(51044508-51044547)
chr4 (143-321)||(1965868-1966048)
chr4 (231-321)||(6987703-6987793)
chr4 (220-321)||(24169270-24169372)
chr4 (289-323)||(32278369-32278403)
chr4 (140-178)||(32920505-32920543)
chr4 (142-196)||(47970245-47970299)
chr4 (246-324)||(48719350-48719428)
chr4 (196-329)||(52746793-52746927)
chr4 (162-362)||(679663-679865)
chr4 (271-316)||(1554975-1555020)
chr4 (133-178)||(2980578-2980623)
chr4 (139-188)||(4191663-4191712)
chr4 (271-362)||(6428076-6428169)
chr4 (227-284)||(19422412-19422469)
chr4 (133-178)||(46796936-46796981)
chr4 (288-321)||(49940128-49940161)
chr4 (219-255)||(25717504-25717540)
chr4 (219-251)||(27623644-27623676)
chr4 (220-324)||(27721724-27721828)
chr4 (214-250)||(27970059-27970095)
chr4 (233-305)||(29388804-29388876)
chr4 (214-250)||(42866069-42866105)
[»] chr3 (63 HSPs)
chr3 (145-329)||(44295462-44295643)
chr3 (196-315)||(21367650-21367770)
chr3 (139-305)||(1816506-1816675)
chr3 (95-329)||(30573868-30574100)
chr3 (222-364)||(45541580-45541724)
chr3 (155-284)||(24785145-24785276)
chr3 (214-325)||(14548679-14548790)
chr3 (147-329)||(20192560-20192744)
chr3 (220-329)||(37273141-37273250)
chr3 (151-329)||(49465619-49465797)
chr3 (227-316)||(50952347-50952436)
chr3 (195-316)||(54837001-54837122)
chr3 (214-321)||(18405792-18405900)
chr3 (214-284)||(3044258-3044328)
chr3 (230-361)||(24281064-24281197)
chr3 (220-300)||(39602193-39602273)
chr3 (214-321)||(39980730-39980838)
chr3 (271-364)||(44014715-44014810)
chr3 (289-329)||(50211811-50211851)
chr3 (273-336)||(20194980-20195043)
chr3 (200-255)||(22203417-22203472)
chr3 (223-322)||(27896131-27896230)
chr3 (223-333)||(2152128-2152238)
chr3 (222-316)||(21574499-21574593)
chr3 (220-326)||(24624217-24624323)
chr3 (214-316)||(40880915-40881017)
chr3 (230-324)||(47513670-47513764)
chr3 (245-302)||(5391911-5391968)
chr3 (235-284)||(25925764-25925813)
chr3 (140-196)||(905059-905115)
chr3 (220-312)||(20467157-20467249)
chr3 (220-284)||(20669179-20669243)
chr3 (220-260)||(24158526-24158566)
chr3 (133-189)||(25964360-25964416)
chr3 (160-325)||(36646340-36646507)
chr3 (220-284)||(40665436-40665500)
chr3 (136-196)||(41028940-41029000)
chr3 (222-265)||(2825156-2825199)
chr3 (139-178)||(16790463-16790502)
chr3 (141-196)||(34958254-34958309)
chr3 (278-329)||(50760656-50760707)
chr3 (220-250)||(24887316-24887346)
chr3 (289-363)||(25182908-25182981)
chr3 (271-329)||(25258830-25258888)
chr3 (240-314)||(33880526-33880599)
chr3 (288-363)||(47903998-47904075)
chr3 (291-329)||(50015964-50016002)
chr3 (240-314)||(53952075-53952149)
chr3 (276-329)||(2413633-2413686)
chr3 (220-321)||(3845524-3845625)
chr3 (341-374)||(16072948-16072981)
chr3 (227-316)||(23808031-23808120)
chr3 (220-265)||(24280718-24280763)
chr3 (220-249)||(44284114-44284143)
chr3 (220-317)||(50600144-50600241)
chr3 (219-329)||(52323848-52323960)
chr3 (219-255)||(8933793-8933829)
chr3 (214-305)||(24085315-24085407)
chr3 (246-321)||(31365149-31365225)
chr3 (289-329)||(34707450-34707490)
chr3 (273-305)||(36769949-36769981)
chr3 (136-196)||(44374733-44374793)
chr3 (220-260)||(45535241-45535281)
[»] chr8 (61 HSPs)
chr8 (145-314)||(42215275-42215446)
chr8 (214-330)||(39551162-39551278)
chr8 (219-317)||(12851182-12851280)
chr8 (220-329)||(11569411-11569520)
chr8 (220-284)||(20672757-20672821)
chr8 (219-305)||(26473730-26473816)
chr8 (220-314)||(30389106-30389200)
chr8 (219-316)||(7918413-7918510)
chr8 (146-233)||(926418-926508)
chr8 (221-265)||(1433556-1433600)
chr8 (214-317)||(9956779-9956883)
chr8 (271-364)||(16162818-16162913)
chr8 (221-321)||(27754412-27754512)
chr8 (220-310)||(1930042-1930133)
chr8 (95-180)||(4389826-4389908)
chr8 (214-305)||(5088853-5088944)
chr8 (240-364)||(9700028-9700154)
chr8 (222-329)||(30191095-30191202)
chr8 (220-299)||(35220707-35220786)
chr8 (219-305)||(2458544-2458630)
chr8 (238-315)||(10120781-10120859)
chr8 (134-196)||(14482121-14482183)
chr8 (220-254)||(25097393-25097427)
chr8 (262-316)||(41442420-41442474)
chr8 (222-329)||(42215044-42215143)
chr8 (133-364)||(28769256-28769491)
chr8 (214-255)||(43709274-43709315)
chr8 (220-329)||(44236777-44236886)
chr8 (289-329)||(2487962-2488002)
chr8 (220-260)||(9836877-9836917)
chr8 (154-305)||(13459585-13459737)
chr8 (214-329)||(24558854-24558967)
chr8 (177-329)||(34849065-34849220)
chr8 (238-321)||(35643949-35644033)
chr8 (220-312)||(40071756-40071848)
chr8 (133-176)||(6918949-6918992)
chr8 (220-255)||(27028838-27028873)
chr8 (146-267)||(34522070-34522195)
chr8 (289-364)||(6526169-6526246)
chr8 (154-329)||(7646145-7646322)
chr8 (219-329)||(10923602-10923712)
chr8 (286-332)||(10939448-10939494)
chr8 (155-250)||(13561345-13561442)
chr8 (220-329)||(26410286-26410396)
chr8 (220-249)||(6509337-6509366)
chr8 (222-255)||(10075579-10075612)
chr8 (223-284)||(11795102-11795163)
chr8 (220-330)||(12361199-12361311)
chr8 (271-316)||(25097433-25097478)
chr8 (214-255)||(34551121-34551162)
chr8 (276-329)||(34770931-34770984)
chr8 (169-239)||(38537545-38537617)
chr8 (291-332)||(41398059-41398100)
chr8 (289-329)||(778465-778505)
chr8 (281-329)||(24326099-24326147)
chr8 (146-194)||(26215427-26215475)
chr8 (273-313)||(30947433-30947473)
chr8 (220-268)||(31862500-31862548)
chr8 (211-255)||(39881780-39881824)
chr8 (133-172)||(40859831-40859871)
chr8 (220-328)||(43504758-43504866)
[»] chr1 (66 HSPs)
chr1 (224-329)||(31517694-31517799)
chr1 (220-314)||(37811859-37811953)
chr1 (154-292)||(36151496-36151636)
chr1 (142-364)||(17269177-17269403)
chr1 (219-303)||(35925696-35925780)
chr1 (153-329)||(10199362-10199540)
chr1 (222-328)||(4445717-4445823)
chr1 (223-329)||(37593638-37593744)
chr1 (221-329)||(49692006-49692112)
chr1 (137-196)||(870967-871026)
chr1 (153-265)||(35017512-35017628)
chr1 (214-300)||(25479582-25479668)
chr1 (138-268)||(4200152-4200284)
chr1 (200-329)||(7136952-7137081)
chr1 (196-284)||(7472294-7472383)
chr1 (219-308)||(24460382-24460471)
chr1 (220-329)||(33723336-33723445)
chr1 (162-310)||(3924571-3924721)
chr1 (222-329)||(6279408-6279515)
chr1 (220-362)||(172492-172639)
chr1 (214-268)||(7218089-7218143)
chr1 (136-295)||(10854654-10854815)
chr1 (214-304)||(37842334-37842424)
chr1 (222-304)||(43338125-43338207)
chr1 (224-329)||(32515395-32515500)
chr1 (288-329)||(43371845-43371886)
chr1 (222-294)||(5047155-5047227)
chr1 (222-326)||(7262475-7262579)
chr1 (219-299)||(11137851-11137930)
chr1 (220-300)||(11639399-11639479)
chr1 (214-254)||(25005826-25005866)
chr1 (214-359)||(29723490-29723637)
chr1 (219-255)||(38651459-38651495)
chr1 (214-250)||(47598454-47598490)
chr1 (220-315)||(4576812-4576907)
chr1 (222-301)||(4699597-4699676)
chr1 (238-329)||(6292518-6292608)
chr1 (220-311)||(10744308-10744399)
chr1 (137-255)||(19389824-19389943)
chr1 (227-314)||(28689421-28689508)
chr1 (196-299)||(39596580-39596682)
chr1 (222-329)||(44422708-44422815)
chr1 (275-329)||(5421898-5421952)
chr1 (232-298)||(11695880-11695946)
chr1 (227-329)||(19092338-19092439)
chr1 (271-329)||(27807173-27807231)
chr1 (271-321)||(38001654-38001704)
chr1 (222-260)||(45667785-45667823)
chr1 (249-314)||(4481966-4482031)
chr1 (220-329)||(4622100-4622209)
chr1 (289-362)||(5886911-5886982)
chr1 (288-329)||(8382416-8382457)
chr1 (196-245)||(23445317-23445366)
chr1 (214-267)||(26779941-26779994)
chr1 (219-284)||(30257689-30257754)
chr1 (160-314)||(33185927-33186082)
chr1 (146-252)||(33527178-33527286)
chr1 (271-324)||(38170649-38170702)
chr1 (220-305)||(39270403-39270488)
chr1 (276-329)||(42336678-42336731)
chr1 (139-329)||(44031953-44032145)
chr1 (137-194)||(52286600-52286657)
chr1 (221-317)||(5591932-5592028)
chr1 (289-329)||(36070257-36070297)
chr1 (219-255)||(37241850-37241886)
chr1 (214-321)||(49938748-49938856)
[»] chr2 (76 HSPs)
chr2 (152-334)||(39621890-39622072)
chr2 (219-329)||(12313127-12313237)
chr2 (196-302)||(33941892-33941998)
chr2 (160-329)||(787276-787448)
chr2 (223-316)||(33192212-33192304)
chr2 (214-329)||(35485918-35486033)
chr2 (198-329)||(40158703-40158834)
chr2 (219-329)||(38078364-38078474)
chr2 (220-305)||(35378994-35379079)
chr2 (198-305)||(42419982-42420089)
chr2 (196-321)||(1625883-1626009)
chr2 (219-313)||(15120189-15120283)
chr2 (153-268)||(43259772-43259889)
chr2 (220-284)||(1939331-1939395)
chr2 (262-329)||(5902503-5902570)
chr2 (146-250)||(10143103-10143209)
chr2 (234-363)||(43529776-43529907)
chr2 (271-329)||(1801726-1801784)
chr2 (271-329)||(4350748-4350806)
chr2 (214-260)||(9477953-9477999)
chr2 (222-284)||(34652035-34652097)
chr2 (214-260)||(36863648-36863694)
chr2 (138-329)||(11513824-11514012)
chr2 (245-314)||(13220465-13220534)
chr2 (220-329)||(16867746-16867854)
chr2 (223-316)||(32106766-32106859)
chr2 (221-310)||(33256748-33256837)
chr2 (235-312)||(38809348-38809425)
chr2 (214-255)||(39983343-39983384)
chr2 (155-268)||(4090289-4090404)
chr2 (219-323)||(6993684-6993788)
chr2 (220-260)||(10884544-10884584)
chr2 (214-321)||(20952356-20952464)
chr2 (219-255)||(24097814-24097850)
chr2 (238-363)||(28677577-28677704)
chr2 (144-313)||(28933753-28933923)
chr2 (245-305)||(31096333-31096393)
chr2 (222-314)||(41817177-41817269)
chr2 (224-296)||(44438826-44438898)
chr2 (223-321)||(750680-750779)
chr2 (223-314)||(1494415-1494506)
chr2 (220-255)||(3049981-3050016)
chr2 (222-253)||(9530758-9530789)
chr2 (227-298)||(25790140-25790211)
chr2 (288-331)||(32837398-32837441)
chr2 (196-255)||(40279180-40279239)
chr2 (342-372)||(4508312-4508342)
chr2 (138-196)||(17952790-17952848)
chr2 (214-284)||(33942151-33942221)
chr2 (214-268)||(40279408-40279462)
chr2 (153-254)||(43299430-43299535)
chr2 (224-305)||(43570425-43570506)
chr2 (222-299)||(680512-680589)
chr2 (276-329)||(1318299-1318352)
chr2 (227-304)||(1647250-1647327)
chr2 (139-196)||(3102617-3102674)
chr2 (220-305)||(9556246-9556331)
chr2 (134-258)||(10190198-10190323)
chr2 (139-176)||(26484193-26484230)
chr2 (145-235)||(33931618-33931710)
chr2 (220-305)||(35378510-35378595)
chr2 (219-292)||(43173228-43173301)
chr2 (160-321)||(43279488-43279652)
chr2 (139-196)||(43530200-43530257)
chr2 (214-255)||(43985031-43985072)
chr2 (233-329)||(13234526-13234622)
chr2 (220-268)||(13736308-13736356)
chr2 (289-329)||(13866954-13866994)
chr2 (220-260)||(19629370-19629410)
chr2 (220-260)||(19826271-19826311)
chr2 (133-177)||(29318790-29318834)
chr2 (166-241)||(29628785-29628861)
chr2 (214-278)||(40279268-40279332)
chr2 (214-278)||(40279338-40279402)
chr2 (220-268)||(43205316-43205364)
chr2 (273-325)||(43530069-43530121)
[»] chr6 (40 HSPs)
chr6 (160-326)||(33887775-33887943)
chr6 (196-321)||(20368142-20368267)
chr6 (220-304)||(31624097-31624181)
chr6 (163-255)||(31776303-31776396)
chr6 (138-310)||(9093528-9093704)
chr6 (197-255)||(31812041-31812099)
chr6 (146-195)||(3171521-3171570)
chr6 (219-316)||(8035115-8035212)
chr6 (220-325)||(31686321-31686426)
chr6 (220-329)||(32171337-32171446)
chr6 (220-321)||(33089513-33089614)
chr6 (146-255)||(4006645-4006756)
chr6 (137-250)||(4248880-4248995)
chr6 (220-284)||(6647394-6647458)
chr6 (199-267)||(7945900-7945967)
chr6 (139-191)||(31668779-31668831)
chr6 (219-312)||(103437-103530)
chr6 (220-329)||(34403862-34403971)
chr6 (222-314)||(2263201-2263293)
chr6 (160-316)||(2735014-2735173)
chr6 (220-300)||(28641732-28641812)
chr6 (219-331)||(32386515-32386627)
chr6 (220-331)||(769146-769256)
chr6 (143-194)||(32861356-32861407)
chr6 (246-304)||(1575928-1575986)
chr6 (220-286)||(4246417-4246483)
chr6 (220-314)||(4324423-4324516)
chr6 (222-284)||(4420652-4420714)
chr6 (271-321)||(9202952-9203002)
chr6 (143-197)||(33259744-33259798)
chr6 (133-238)||(33826780-33826884)
chr6 (139-196)||(3217279-3217336)
chr6 (144-250)||(6654544-6654652)
chr6 (280-329)||(10353715-10353764)
chr6 (220-325)||(33116591-33116696)
chr6 (240-329)||(35070421-35070510)
chr6 (219-255)||(2205618-2205654)
chr6 (136-196)||(2514623-2514683)
chr6 (224-284)||(31324467-31324527)
chr6 (271-327)||(34544100-34544156)
[»] chr5 (48 HSPs)
chr5 (133-250)||(912681-912801)
chr5 (160-307)||(17368621-17368770)
chr5 (133-310)||(39105381-39105562)
chr5 (220-329)||(17258837-17258946)
chr5 (133-253)||(18543226-18543349)
chr5 (154-304)||(18857377-18857531)
chr5 (219-323)||(37611175-37611279)
chr5 (219-323)||(37787905-37788009)
chr5 (220-307)||(13604825-13604912)
chr5 (214-328)||(2568659-2568773)
chr5 (220-300)||(21768180-21768260)
chr5 (214-329)||(12459955-12460070)
chr5 (131-189)||(11684339-11684397)
chr5 (271-329)||(25720371-25720429)
chr5 (224-329)||(4619718-4619823)
chr5 (146-278)||(4014429-4014563)
chr5 (196-323)||(6587067-6587194)
chr5 (133-196)||(20982224-20982287)
chr5 (214-321)||(37526161-37526268)
chr5 (214-321)||(37588322-37588429)
chr5 (275-329)||(499685-499739)
chr5 (220-310)||(11707062-11707152)
chr5 (137-267)||(31694440-31694572)
chr5 (220-329)||(33533494-33533602)
chr5 (222-326)||(10125675-10125779)
chr5 (214-321)||(29925842-29925950)
chr5 (220-320)||(36638754-36638854)
chr5 (183-255)||(10272459-10272533)
chr5 (138-189)||(10391276-10391327)
chr5 (220-255)||(40731476-40731511)
chr5 (133-267)||(12425488-12425625)
chr5 (214-284)||(14674899-14674969)
chr5 (214-284)||(15308992-15309062)
chr5 (133-195)||(19177397-19177459)
chr5 (220-250)||(38047888-38047918)
chr5 (219-249)||(40205108-40205138)
chr5 (138-195)||(1961915-1961972)
chr5 (220-312)||(28777000-28777093)
chr5 (220-293)||(41957441-41957514)
chr5 (146-252)||(42646846-42646954)
chr5 (223-255)||(3970708-3970740)
chr5 (133-189)||(19113213-19113269)
chr5 (137-189)||(26516220-26516272)
chr5 (223-255)||(30217092-30217124)
chr5 (219-255)||(32545040-32545076)
chr5 (214-254)||(34117565-34117605)
chr5 (214-321)||(37690598-37690706)
chr5 (220-284)||(41052875-41052939)
[»] chr7 (45 HSPs)
chr7 (147-329)||(28165023-28165207)
chr7 (146-300)||(12110291-12110447)
chr7 (138-255)||(47941243-47941365)
chr7 (137-250)||(39169449-39169563)
chr7 (223-322)||(27626084-27626183)
chr7 (220-321)||(20526453-20526555)
chr7 (219-329)||(25670540-25670650)
chr7 (152-255)||(46945846-46945951)
chr7 (95-255)||(48131231-48131390)
chr7 (220-284)||(529382-529446)
chr7 (219-363)||(28691754-28691899)
chr7 (198-261)||(39542322-39542385)
chr7 (196-267)||(44821942-44822013)
chr7 (200-334)||(752956-753090)
chr7 (227-328)||(3836638-3836738)
chr7 (222-267)||(25596042-25596087)
chr7 (228-329)||(33894642-33894743)
chr7 (244-329)||(44808189-44808274)
chr7 (131-323)||(5628526-5628720)
chr7 (220-312)||(7244687-7244779)
chr7 (214-305)||(39967921-39968013)
chr7 (219-255)||(48917374-48917410)
chr7 (200-255)||(3968785-3968840)
chr7 (238-329)||(22387850-22387941)
chr7 (220-255)||(27378856-27378891)
chr7 (137-196)||(35536029-35536088)
chr7 (139-178)||(45078217-45078256)
chr7 (142-249)||(3610774-3610883)
chr7 (133-195)||(5373143-5373205)
chr7 (275-329)||(8094368-8094422)
chr7 (288-357)||(13960648-13960718)
chr7 (246-304)||(15740390-15740448)
chr7 (160-255)||(17989051-17989148)
chr7 (138-188)||(22388001-22388051)
chr7 (271-329)||(36537966-36538024)
chr7 (154-244)||(1417203-1417295)
chr7 (222-315)||(22551373-22551466)
chr7 (214-255)||(24363629-24363670)
chr7 (222-255)||(30723067-30723100)
chr7 (139-196)||(45593808-45593865)
chr7 (214-255)||(46104595-46104636)
chr7 (222-314)||(5276240-5276332)
chr7 (220-304)||(9038119-9038202)
chr7 (220-252)||(18350738-18350770)
chr7 (214-266)||(47130802-47130854)
[»] scaffold0022 (1 HSPs)
scaffold0022 (137-189)||(143157-143209)
[»] scaffold0590 (1 HSPs)
scaffold0590 (140-196)||(1163-1219)
[»] scaffold0508 (1 HSPs)
scaffold0508 (136-196)||(9864-9924)
[»] scaffold0275 (1 HSPs)
scaffold0275 (140-196)||(2756-2812)
[»] scaffold0654 (1 HSPs)
scaffold0654 (138-196)||(6726-6784)
[»] scaffold0014 (1 HSPs)
scaffold0014 (138-196)||(116645-116703)
[»] scaffold0608 (1 HSPs)
scaffold0608 (249-314)||(9606-9671)
[»] scaffold0003 (1 HSPs)
scaffold0003 (219-300)||(306332-306413)


Alignment Details
Target: chr4 (Bit Score: 399; Significance: 0; HSPs: 51)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 399; E-Value: 0
Query Start/End: Original strand, 92 - 502
Target Start/End: Complemental strand, 50743027 - 50742617
Alignment:
92 atctttggataaataacttaatttgcaacttacatcataagaagtgcttatcatataagcgcttatggataagctatttttataacacaacataaaatta 191  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
50743027 atctttggataaataacttaatttgcaacttacatcataagaagtgcttatcatataagcgcttatggataagctatttttataacacaacataaaatta 50742928  T
192 agtcattgtttttgtataataaataacttgttttcataagctatcctggagagcttatgaaaatgagtttaaaacagggtatgaacatgtcatgaactgt 291  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||    
50742927 agtcattgtttttgtataataaataacttgttttcataagctatcctggagagcttatgaaaatgagttgaaaacagggtatgaacatgtcatgaactgt 50742828  T
292 tttcataagttctctcaaacagtctaacaagtgcttatacaagaatagcctcaaataagtcaatccaaacaggtcgtaagtgtttatatattaacaatct 391  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
50742827 tttcataagttctctcaaacagtctaacaagtgcttatacaagaatagcctcaaataagtcaatccaaacaggtcgtaagtgtttatatattaacaatct 50742728  T
392 tccagagctcatggaaatgagctgaaaacatgtccatacattgttttcataagttctcctacacaatttcactaatgcttatgtgagtatgtaagttcaa 491  Q
    ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||    
50742727 tccagagctcatggaaatgagctgaaaacatgtccatacattgttgtcataagttctcctacacaatttcacaaatgcttatgtgagtatgtaagttcaa 50742628  T
492 atgagccaata 502  Q
    |||||||||||    
50742627 atgagccaata 50742617  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 61; E-Value: 6e-26
Query Start/End: Original strand, 152 - 329
Target Start/End: Original strand, 2996510 - 2996689
Alignment:
152 gcttatggataagctatttttataacacaacataaaattaagtca--ttgtttttgtataataaataacttgttttcataagctatcctggagagcttat 249  Q
    ||||||| |||||||| ||  |||||| || |||||||  |||||  |||||||| |||||   |||| |||||||||||||||||| |||||||| |||    
2996510 gcttatgaataagctacttcgataacataagataaaatacagtcaaattgtttttatataagttataagttgttttcataagctatcttggagagcgtat 2996609  T
250 gaaaatgagtttaaaacagggtatgaacatgtcatgaactgttttcataagttctctcaaacagtctaacaagtgcttat 329  Q
    |||||| |||| |||| ||  |||| ||||||||| |  |||||||||||| ||||||||||||||| | ||||||||||    
2996610 gaaaataagttgaaaaaagcttatggacatgtcataagttgttttcataagctctctcaaacagtctcaaaagtgcttat 2996689  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 140 - 255
Target Start/End: Complemental strand, 8422982 - 8422867
Alignment:
140 tatcatataagcgcttatggataagctatttttataacacaacataaaattaagtcattgtttttgtataataaataacttgttttcataagctatcctg 239  Q
    ||||||||| | ||||||| ||||||||||||||||| | || ||||||| |||||||||||||  |||||   |||| ||||||||| || ||||| ||    
8422982 tatcatatatgtgcttatgtataagctatttttataaaaaaagataaaataaagtcattgttttcatataagctataagttgttttcacaatctatcttg 8422883  T
240 gagagcttatgaaaat 255  Q
    ||||| ||||| ||||    
8422882 gagagtttatgcaaat 8422867  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 148 - 324
Target Start/End: Original strand, 1137645 - 1137823
Alignment:
148 aagcgcttatggataagctatttttataacacaacataaaattaagtcat--tgtttttgtataataaataacttgttttcataagctatcctggagagc 245  Q
    ||||||||||| |||| |||||| ||||| || | ||||||| |||||||  | |||||| |||||  ||||  || |||||||| ||||||  ||||||    
1137645 aagcgcttatgaataaactatttctataataccatataaaataaagtcatattatttttgaataatctataagctgctttcataaactatccaagagagc 1137744  T
246 ttatgaaaatgagtttaaaacagggtatgaacatgtcatgaactgttttcataagttctctcaaacagtctaacaagtg 324  Q
    ||||| |||| |  | ||||||   |||||||||||||| |  |||||||||||||||||  ||||||| | |||||||    
1137745 ttatggaaataaactgaaaacaacttatgaacatgtcataagatgttttcataagttctcctaaacagtgtcacaagtg 1137823  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 198 - 329
Target Start/End: Complemental strand, 7694095 - 7693965
Alignment:
198 tgtttttgtataataaataacttgttttcataagctatcctggagagcttatgaaaatgagtttaaaacagggtatgaacatgtcatgaactgttttcat 297  Q
    |||||||||||||   ||||  |||||||||||| |||||||||||| ||||| |||| || | ||||||   |||||||||||||| ||||  ||||||    
7694095 tgtttttgtataagctataagctgttttcataagttatcctggagagtttatggaaataagctgaaaacaacttatgaacatgtcattaact-atttcat 7693997  T
298 aagttctctcaaacagtctaacaagtgcttat 329  Q
    ||||| || |||||| ||| | ||||||||||    
7693996 aagttttcacaaacaatcttagaagtgcttat 7693965  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 196 - 315
Target Start/End: Complemental strand, 28300386 - 28300267
Alignment:
196 attgtttttgtataataaataacttgttttcataagctatcctggagagcttatgaaaatgagtttaaaacagggtatgaacatgtcatgaactgttttc 295  Q
    |||||||||||||||   ||||  | |||||||| |||||| || ||||||||||||||| |||| ||||||   || |||||||||||   ||||||||    
28300386 attgtttttgtataagctataaactattttcataggctatcttgaagagcttatgaaaataagttgaaaacaacttaagaacatgtcataggctgttttc 28300287  T
296 ataagttctctcaaacagtc 315  Q
    |||| ||||||||| |||||    
28300286 ataaattctctcaatcagtc 28300267  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 196 - 321
Target Start/End: Complemental strand, 50681176 - 50681050
Alignment:
196 attgtttttgtataataaataacttgttttcataagctatcctggagagcttatgaaaatgagtttaaaacagggtatgaacat-gtcatgaactgtttt 294  Q
    ||||||||||||||    |||| ||||||  |||||||||  ||||||  |||||||||| | || |||| ||  |||||| || ||||| |||||||||    
50681176 attgtttttgtatatgctataagttgtttatataagctatattggagaaattatgaaaataaattgaaaaaagcttatgaaaattgtcattaactgtttt 50681077  T
295 cataagttctctcaaacagtctaacaa 321  Q
    |||||||||||||||||||||| ||||    
50681076 cataagttctctcaaacagtctcacaa 50681050  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 161 - 255
Target Start/End: Original strand, 17884014 - 17884110
Alignment:
161 taagctatttttataacacaacataaaattaagtca--ttgtttttgtataataaataacttgttttcataagctatcctggagagcttatgaaaat 255  Q
    |||||||||| ||||||| || ||||||| |||| |  ||||||||||||||   || | |||||||||||||||||  ||||||||||||||||||    
17884014 taagctatttctataacaaaagataaaataaagttaaattgtttttgtataagttatcagttgttttcataagctatattggagagcttatgaaaat 17884110  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #9
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 147 - 284
Target Start/End: Complemental strand, 6466184 - 6466045
Alignment:
147 taagcgcttatggataagctatttttataacacaacataaaattaagtca--ttgtttttgtataataaataacttgttttcataagctatcctggagag 244  Q
    |||||||||||| ||||| | ||| |||||||||| || |||| |||| |  || ||||||||||||  |||| |||||| |||||||||| || |||||    
6466184 taagcgcttatgaataagttgtttatataacacaagatcaaataaagtgaaattctttttgtataatctataagttgtttccataagctattctagagag 6466085  T
245 cttatgaaaatgagtttaaaacagggtatgaacatgtcat 284  Q
     ||||| |||| |||| |||| ||  ||||||||| ||||    
6466084 attatggaaataagttgaaaatagcttatgaacatctcat 6466045  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #10
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 161 - 302
Target Start/End: Complemental strand, 20936353 - 20936210
Alignment:
161 taagctatttttataacacaacataaaattaagtca--ttgtttttgtataataaataacttgttttcataagctatcctggagagcttatgaaaatgag 258  Q
    |||||||| | |||||| |||  |||||| ||||||  |||||||| ||||||  |||  |||||||||||  ||||||||||||| ||||| |||| ||    
20936353 taagctatatctataacgcaaggtaaaatgaagtcaaattgtttttatataatctataggttgttttcatattctatcctggagagattatggaaataag 20936254  T
259 tttaaaacagggtatgaacatgtcatgaactgttttcataagtt 302  Q
     | |||||||  ||||||||| |||| |  ||||||||||||||    
20936253 gtgaaaacagcttatgaacatatcataagttgttttcataagtt 20936210  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #11
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 138 - 249
Target Start/End: Original strand, 3891500 - 3891611
Alignment:
138 cttatcatataagcgcttatggataagctatttttataacacaacataaaattaagtc--attgtttttgtataataaataacttgttttcataagctat 235  Q
    ||||||||||||| ||||||| |||| |||||| |||||||  |  |||||| |||||  |  ||||||||||||||  ||| ||||||| |||||||||    
3891500 cttatcatataagtgcttatgaataaactatttctataacagga--taaaataaagtcgaaccgtttttgtataatatgtaagttgtttttataagctat 3891597  T
236 cctggagagcttat 249  Q
    ||| ||||||||||    
3891598 cctagagagcttat 3891611  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #12
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 227 - 324
Target Start/End: Complemental strand, 17751200 - 17751106
Alignment:
227 ataagctatcctggagagcttatgaaaatgagtttaaaacagggtatgaacatgtcatgaactgttttcataagttctctcaaacagtctaacaagtg 324  Q
    |||||||||| || ||||||||||||||| || ||||||||   |||||||||||| | | |||||||||  ||||||  |||||||||| |||||||    
17751200 ataagctatcttgcagagcttatgaaaataagcttaaaaca---tatgaacatgtcgtaagctgttttcaagagttcttccaaacagtctcacaagtg 17751106  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #13
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 140 - 256
Target Start/End: Original strand, 18630605 - 18630723
Alignment:
140 tatcatataagcgcttatggataagctatttttataacacaacataaaattaagtca--ttgtttttgtataataaataacttgttttcataagctatcc 237  Q
    ||||||||||||||||||| |||| ||||||  |||||| || ||||||| ||||||  | |||||  |||||   |||| ||||||||| |||||||||    
18630605 tatcatataagcgcttatgcataaactatttcaataacaaaagataaaataaagtcaattggttttcatataagctataagttgttttcacaagctatcc 18630704  T
238 tggagagcttatgaaaatg 256  Q
       ||||||||||||||||    
18630705 aacagagcttatgaaaatg 18630723  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #14
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 220 - 323
Target Start/End: Complemental strand, 21043298 - 21043195
Alignment:
220 tgttttcataagctatcctggagagcttatgaaaatgagtttaaaacagggtatgaacatgtcatgaactgttttcataagttctctcaaacagtctaac 319  Q
    |||||||||||||||||||| ||||| |||||||||    | |||||||  ||||||| |||||| | |||||| |||||  |||| |||||||||| ||    
21043298 tgttttcataagctatcctgaagagcatatgaaaatacactgaaaacagcttatgaacgtgtcataagctgtttccataacctctcccaaacagtctcac 21043199  T
320 aagt 323  Q
    ||||    
21043198 aagt 21043195  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #15
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 286 - 329
Target Start/End: Original strand, 22471347 - 22471390
Alignment:
286 aactgttttcataagttctctcaaacagtctaacaagtgcttat 329  Q
    |||||||||||||||||||| |||||||||| ||||||||||||    
22471347 aactgttttcataagttctcccaaacagtctcacaagtgcttat 22471390  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #16
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 220 - 321
Target Start/End: Original strand, 1706629 - 1706731
Alignment:
220 tgttttcataagctatcctggagagcttatgaaaatgagtttaaaacagggtatgaac-atgtcatgaactgttttcataagttctctcaaacagtctaa 318  Q
    ||||||||||| ||||| |||| ||||||||||||| ||||  ||| ||  ||||||| ||| ||| | |||||||||||| ||||||||||| |||| |    
1706629 tgttttcataaactatcttggacagcttatgaaaataagttggaaatagcttatgaacaatgccataagctgttttcataatttctctcaaaccgtctca 1706728  T
319 caa 321  Q
    |||    
1706729 caa 1706731  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #17
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 288 - 330
Target Start/End: Original strand, 4071953 - 4071995
Alignment:
288 ctgttttcataagttctctcaaacagtctaacaagtgcttata 330  Q
    ||||||||||||| ||||||||||||||| |||||||||||||    
4071953 ctgttttcataagctctctcaaacagtctcacaagtgcttata 4071995  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #18
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 160 - 267
Target Start/End: Original strand, 10192229 - 10192337
Alignment:
160 ataagctatttttataacacaacataaaattaagtca--ttgtttttgtataataaataacttgttttcataagctatcctggagagcttatgaaaatga 257  Q
    |||| |||||||||||||| || ||| ||| ||||||  |||||||  |||||   |||| ||||||||| ||||||||||||||||| ||||||||| |    
10192229 ataaactatttttataacaaaagatagaataaagtcaaattgttttcatataagttataagttgttttcaaaagctatcctggagagc-tatgaaaataa 10192327  T
258 gtttaaaaca 267  Q
    ||| ||||||    
10192328 gttgaaaaca 10192337  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #19
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 214 - 284
Target Start/End: Original strand, 11264302 - 11264372
Alignment:
214 ataacttgttttcataagctatcctggagagcttatgaaaatgagtttaaaacagggtatgaacatgtcat 284  Q
    |||| |||||||||||||| ||||| ||||||||||| |||| |||| |||||||  |||| |||||||||    
11264302 ataagttgttttcataagccatcctagagagcttatggaaataagttgaaaacagtttatggacatgtcat 11264372  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #20
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 276 - 329
Target Start/End: Complemental strand, 3549562 - 3549509
Alignment:
276 acatgtcatgaactgttttcataagttctctcaaacagtctaacaagtgcttat 329  Q
    |||||||||  ||| |||||||||||||||||||||||||| | ||||||||||    
3549562 acatgtcatacactattttcataagttctctcaaacagtctcataagtgcttat 3549509  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #21
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 219 - 324
Target Start/End: Complemental strand, 4798630 - 4798525
Alignment:
219 ttgttttcataagctatcctggagagcttatgaaaatgagtttaaaacagggtatgaacatgtcatgaactgttttcataagttctctcaaacagtctaa 318  Q
    |||||||||||||||||| ||||||||||||| |||| || | |||||||  |||| ||||||||  | | |||| |||||| |||  | |||||||| |    
4798630 ttgttttcataagctatcttggagagcttatgcaaataagctcaaaacagcttatgtacatgtcagaagccgtttccataagctcttcctaacagtctca 4798531  T
319 caagtg 324  Q
    ||||||    
4798530 caagtg 4798525  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #22
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 131 - 329
Target Start/End: Original strand, 21157684 - 21157884
Alignment:
131 agaagtgcttatcatataagcgcttatggataagctatttttataacacaacataaaattaagtcat--tgtttttgtataataaataacttgttttcat 228  Q
    ||||||| |||||||||||| ||||||| || ||||||||| |||||| |  ||||| | ||||||   ||||||  | |||   ||||  |||||||||    
21157684 agaagtgtttatcatataagtgcttatgtatcagctattttgataacaaagtataaactaaagtcaaactgttttcatgtaagctataagatgttttcat 21157783  T
229 aagctatcctggagagcttatgaaaatgagtttaaaacagggtatgaacatgtcatgaactgttttcataagttctctcaaacagtctaacaagtgctta 328  Q
    | ||||||||| |||||||||| |||| || | |||||||  | || | ||||||| | ||||||   |||| |||  |||||||||| |||||||||||    
21157784 atgctatcctgaagagcttatggaaataagctaaaaacagcttttgtaaatgtcataagctgtttctgtaagctcttccaaacagtcttacaagtgctta 21157883  T
329 t 329  Q
    |    
21157884 t 21157884  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #23
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 139 - 196
Target Start/End: Complemental strand, 51556013 - 51555956
Alignment:
139 ttatcatataagcgcttatggataagctatttttataacacaacataaaattaagtca 196  Q
    |||||||||||| ||||||| |||||||||| |||||||| || ||||||| ||||||    
51556013 ttatcatataagtgcttatgtataagctattattataacaaaagataaaataaagtca 51555956  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #24
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 214 - 305
Target Start/End: Complemental strand, 17822934 - 17822842
Alignment:
214 ataacttgttttcataagctatcctggagagcttatgaaaatgagtttaaaacagggtatg-aacatgtcatgaactgttttcataagttctc 305  Q
    |||| |||||||||||||||||| |||||| ||||||||||| || | |||| ||  |||| || ||||||| | ||||||||||| ||||||    
17822934 ataagttgttttcataagctatcttggagaacttatgaaaataagctaaaaaaagcttatgaaaaatgtcataagctgttttcatatgttctc 17822842  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #25
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 219 - 250
Target Start/End: Original strand, 7730630 - 7730661
Alignment:
219 ttgttttcataagctatcctggagagcttatg 250  Q
    ||||||||||||||||||||||||||||||||    
7730630 ttgttttcataagctatcctggagagcttatg 7730661  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #26
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 219 - 250
Target Start/End: Complemental strand, 11262827 - 11262796
Alignment:
219 ttgttttcataagctatcctggagagcttatg 250  Q
    ||||||||||||||||||||||||||||||||    
11262827 ttgttttcataagctatcctggagagcttatg 11262796  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #27
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 227 - 329
Target Start/End: Complemental strand, 36577599 - 36577496
Alignment:
227 ataagctatcctggagagcttatgaaaatgagtttaaaa-cagggtatgaacatgtcatgaactgttttcataagttctctcaaacagtctaacaagtgc 325  Q
    ||||||||||  ||||| ||||||||||||| || |||| |||  | |||||||||||| |  ||||||  |||||||||  ||||||||| ||||||||    
36577599 ataagctatctgggagaacttatgaaaatgaattgaaaaacagcatttgaacatgtcataagttgtttttgtaagttctccgaaacagtctcacaagtgc 36577500  T
326 ttat 329  Q
    ||||    
36577499 ttat 36577496  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #28
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 220 - 255
Target Start/End: Complemental strand, 39063710 - 39063675
Alignment:
220 tgttttcataagctatcctggagagcttatgaaaat 255  Q
    |||||| |||||||||||||||||||||||||||||    
39063710 tgtttttataagctatcctggagagcttatgaaaat 39063675  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #29
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 216 - 255
Target Start/End: Complemental strand, 51044547 - 51044508
Alignment:
216 aacttgttttcataagctatcctggagagcttatgaaaat 255  Q
    ||||||||||||||||||||||| |||| |||||||||||    
51044547 aacttgttttcataagctatcctagagaacttatgaaaat 51044508  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #30
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 143 - 321
Target Start/End: Original strand, 1965868 - 1966048
Alignment:
143 catataagcgcttatggataagctatttttataacacaacataaaattaag-tca--ttgtttttgtataataaataacttgttttcataagctatcctg 239  Q
    |||||||| ||||||| |||| |||||| |||| ||||| | |||| |||  |||  |||| | ||||||||  |||| || |||| ||||||||||||     
1965868 catataagtgcttatgaataaactatttctatagcacaagagaaaaataaactcaaattgtctgtgtataatttataagttatttttataagctatccta 1965967  T
240 gagagcttatgaaaatgagtttaaaacagggtatgaacatgtcatgaactgttttcataagttctctcaaacagtctaacaa 321  Q
    || | ||| || |||| |||| |||||||  |||||||||||||| |  |||||||||||| || || ||||||||| ||||    
1965968 gaaatcttctggaaataagttaaaaacagcttatgaacatgtcataagttgttttcataagctc-ctaaaacagtctcacaa 1966048  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #31
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 231 - 321
Target Start/End: Complemental strand, 6987793 - 6987703
Alignment:
231 gctatcctggagagcttatgaaaatgagtttaaaacagggtatgaacatgtcatgaactgttttcataagttctctcaaacagtctaacaa 321  Q
    |||||||||||||||||||| |||| |||| |||| ||  |||| ||||||||| |  ||| | |||||| |||| |||||||||| ||||    
6987793 gctatcctggagagcttatggaaataagttgaaaatagtttatggacatgtcataagttgtatccataagctctcccaaacagtctcacaa 6987703  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #32
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 220 - 321
Target Start/End: Original strand, 24169270 - 24169372
Alignment:
220 tgttttcataagctatcctggagagcttatgaaaatgagtttaaaacagggtatg-aacatgtcatgaactgttttcataagttctctcaaacagtctaa 318  Q
    |||||||| |||||||| |||||||||||||||||| |||| |||| |   |||| || ||||||| | || |||| | ||||||||||||| ||||| |    
24169270 tgttttcacaagctatcttggagagcttatgaaaataagttgaaaaaatcttatgaaaaatgtcataagctatttttaaaagttctctcaaatagtctca 24169369  T
319 caa 321  Q
    |||    
24169370 caa 24169372  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #33
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 289 - 323
Target Start/End: Complemental strand, 32278403 - 32278369
Alignment:
289 tgttttcataagttctctcaaacagtctaacaagt 323  Q
    ||||||||||||| |||||||||||||||||||||    
32278403 tgttttcataagtactctcaaacagtctaacaagt 32278369  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #34
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 140 - 178
Target Start/End: Complemental strand, 32920543 - 32920505
Alignment:
140 tatcatataagcgcttatggataagctatttttataaca 178  Q
    ||||||||||| | |||||||||||||||||||||||||    
32920543 tatcatataagtgtttatggataagctatttttataaca 32920505  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #35
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 142 - 196
Target Start/End: Original strand, 47970245 - 47970299
Alignment:
142 tcatataagcgcttatggataagctatttttataacacaacataaaattaagtca 196  Q
    ||||||||| ||||||| ||||||||||| ||||||| || ||||||| ||||||    
47970245 tcatataagtgcttatgtataagctatttctataacaaaagataaaatgaagtca 47970299  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #36
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 246 - 324
Target Start/End: Complemental strand, 48719428 - 48719350
Alignment:
246 ttatgaaaatgagtttaaaacagggtatgaacatgtcatgaactgttttcataagttctctcaaacagtctaacaagtg 324  Q
    |||||||||| || | |||||||  || ||||||||||| |||  ||||||||||||| |||||||| ||| |||||||    
48719428 ttatgaaaataagctgaaaacagcttacgaacatgtcataaaccattttcataagttccctcaaacaatctcacaagtg 48719350  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #37
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 196 - 329
Target Start/End: Complemental strand, 52746927 - 52746793
Alignment:
196 attgtttttgtataataaataacttgttttcataagctatcctggagagcttatgaaaatgagtttaaaacagggtatgaacatgtcatgaactgttttc 295  Q
    ||||||||||| |||   ||||  ||||||||||||||||| || |  |||||||||||| || | |||||||  |||||||||||| | | |||||| |    
52746927 attgtttttgtgtaagccataagctgttttcataagctatcttgtaaggcttatgaaaatcagctgaaaacagcttatgaacatgtcttaagctgtttcc 52746828  T
296 ata-agttctctcaaacagtctaacaagtgcttat 329  Q
    ||| |||| | ||||  ||||| ||||||||||||    
52746827 atatagttttatcaactagtctcacaagtgcttat 52746793  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #38
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 162 - 362
Target Start/End: Original strand, 679663 - 679865
Alignment:
162 aagctatttttataacacaacataaaattaagtca--ttgttttt-gtataataaataacttgttttcataagctatcctgga-gagcttatgaaaatga 257  Q
    ||||||||| ||||| | || |||||||||||| |  |||||||| |||||| | |||| ||||  ||||||| |||| || | ||||||||||||||      
679663 aagctatttctataataaaatataaaattaagttaaattgttttttgtataagatataagttgtagtcataagatatcttgtaagagcttatgaaaatat 679762  T
258 gtttaaaacagggtatgaacatgtcatgaactgttttcataagttctctcaaacagtctaacaagtgcttatacaagaatagcctcaaataagtcaatcc 357  Q
    | | |||||||  ||||||||| |||| |  ||||||||||| ||||  |||  |||||  ||||||||||||| || |||  ||||||| |||||||||    
679763 gctgaaaacagtttatgaacatatcataagatgttttcataacttctaccaagtagtct-ccaagtgcttataccag-ataagctcaaattagtcaatcc 679860  T
358 aaaca 362  Q
    |||||    
679861 aaaca 679865  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #39
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 271 - 316
Target Start/End: Complemental strand, 1555020 - 1554975
Alignment:
271 tatgaacatgtcatgaactgttttcataagttctctcaaacagtct 316  Q
    |||||||||||||| | || ||||||||| ||||||||||||||||    
1555020 tatgaacatgtcataagctattttcataaattctctcaaacagtct 1554975  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #40
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 133 - 178
Target Start/End: Complemental strand, 2980623 - 2980578
Alignment:
133 aagtgcttatcatataagcgcttatggataagctatttttataaca 178  Q
    ||||| |||||||||||| ||||||| ||||||||||| |||||||    
2980623 aagtgtttatcatataagtgcttatgtataagctatttctataaca 2980578  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #41
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 139 - 188
Target Start/End: Original strand, 4191663 - 4191712
Alignment:
139 ttatcatataagcgcttatggataagctatttttataacacaacataaaa 188  Q
    |||||||||||| ||||||| ||||||||||| ||||||| || ||||||    
4191663 ttatcatataagtgcttatgtataagctatttctataacaaaagataaaa 4191712  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #42
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 271 - 362
Target Start/End: Original strand, 6428076 - 6428169
Alignment:
271 tatgaacatgtcatgaactgttttcataagttctctcaaacagtctaacaagtgcttata-caaga-atagcctcaaataagtcaatccaaaca 362  Q
    |||| ||||||||| |  |||||||||||  |||||||||| |||| ||||||||||||| ||| | |||  ||||||||||||||| ||||||    
6428076 tatggacatgtcataagttgttttcataatctctctcaaactgtctcacaagtgcttataccaatatataagctcaaataagtcaattcaaaca 6428169  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #43
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 227 - 284
Target Start/End: Original strand, 19422412 - 19422469
Alignment:
227 ataagctatcctggagagcttatgaaaatgagtttaaaacagggtatgaacatgtcat 284  Q
    |||| ||||||||||||||||||| |||| |||| |||| || ||||| |||||||||    
19422412 ataaactatcctggagagcttatggaaataagttgaaaaaagcgtatgcacatgtcat 19422469  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #44
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 133 - 178
Target Start/End: Original strand, 46796936 - 46796981
Alignment:
133 aagtgcttatcatataagcgcttatggataagctatttttataaca 178  Q
    ||||||||||||||||||  |||||| |||||||||||| ||||||    
46796936 aagtgcttatcatataagttcttatgcataagctattttcataaca 46796981  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #45
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 288 - 321
Target Start/End: Complemental strand, 49940161 - 49940128
Alignment:
288 ctgttttcataagttctctcaaacagtctaacaa 321  Q
    ||||||||||||||||||||||||||||| ||||    
49940161 ctgttttcataagttctctcaaacagtctcacaa 49940128  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #46
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 219 - 255
Target Start/End: Original strand, 25717504 - 25717540
Alignment:
219 ttgttttcataagctatcctggagagcttatgaaaat 255  Q
    |||||||||||| | ||||||||||||||||||||||    
25717504 ttgttttcataaacaatcctggagagcttatgaaaat 25717540  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #47
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 219 - 251
Target Start/End: Original strand, 27623644 - 27623676
Alignment:
219 ttgttttcataagctatcctggagagcttatga 251  Q
    ||||||||||||| |||||||||||||||||||    
27623644 ttgttttcataagttatcctggagagcttatga 27623676  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #48
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 220 - 324
Target Start/End: Original strand, 27721724 - 27721828
Alignment:
220 tgttttcataagctatcctggagagcttatgaaaatgagtttaaaacagggtatgaacatgtcatgaactgttttcataagttctctcaaacagtctaac 319  Q
    |||||||||||| |||||||||||||||  |||||| || | |||||||  |||| | ||||||| |   ||||| ||||| ||||| ||||| ||| ||    
27721724 tgttttcataagttatcctggagagcttgcgaaaataagctgaaaacagcttatggatatgtcataagtagtttttataagctctcttaaacaatctcac 27721823  T
320 aagtg 324  Q
    |||||    
27721824 aagtg 27721828  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #49
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 214 - 250
Target Start/End: Original strand, 27970059 - 27970095
Alignment:
214 ataacttgttttcataagctatcctggagagcttatg 250  Q
    |||||||||||||||||||| || |||||||||||||    
27970059 ataacttgttttcataagctgtcatggagagcttatg 27970095  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #50
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 233 - 305
Target Start/End: Original strand, 29388804 - 29388876
Alignment:
233 tatcctggagagcttatgaaaatgagtttaaaacagggtatgaacatgtcatgaactgttttcataagttctc 305  Q
    ||||||||||||||| || |||| ||||| ||||||  |||||||||||| | | ||||||||  ||||||||    
29388804 tatcctggagagcttgtggaaataagtttgaaacagattatgaacatgtcttaagctgttttcgcaagttctc 29388876  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #51
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 214 - 250
Target Start/End: Original strand, 42866069 - 42866105
Alignment:
214 ataacttgttttcataagctatcctggagagcttatg 250  Q
    |||| |||||||||||||||||||| |||||||||||    
42866069 ataagttgttttcataagctatccttgagagcttatg 42866105  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 58; Significance: 3e-24; HSPs: 63)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 145 - 329
Target Start/End: Original strand, 44295462 - 44295643
Alignment:
145 tataagcgcttatggataagctatttttataacacaacataaaattaagtcattgtttttgtataataaataacttgttttcataagctatcctggagag 244  Q
    ||||||||||| || ||||||||||| |||||| ||| ||||||| || ||||| ||||| ||||||  |||| ||||||||||||| |||   ||||||    
44295462 tataagcgcttgtgaataagctatttctataactcaagataaaataaaatcatttttttt-tataatctataagttgttttcataagatatatcggagag 44295560  T
245 cttatgaaaatgagtttaaaacagggtatgaacatgtcatgaactgttttcataagttctctcaaacagtctaacaagtgcttat 329  Q
    |||||| |||| || | |||||||  ||| ||  |||||||||  ||||||||||||||||||||| ||| | ||||||||||||    
44295561 cttatggaaataagctgaaaacagaatataaa--tgtcatgaatagttttcataagttctctcaaatagtatcacaagtgcttat 44295643  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 196 - 315
Target Start/End: Original strand, 21367650 - 21367770
Alignment:
196 attgtttttgtataataaataacttgttttcataagctatcctggagagcttatgaaaatgagtttaaaacagggtatgaac-atgtcatgaactgtttt 294  Q
    |||||||| |||||||  |||| |||||||||||||||||| |||||| ||||||||||| || | |||||||  | ||||| ||||||| | |||||||    
21367650 attgttttcgtataatgtataagttgttttcataagctatcttggagaacttatgaaaataagctgaaaacagcttgtgaacaatgtcataagctgtttt 21367749  T
295 cataagttctctcaaacagtc 315  Q
    ||||||||||| |||||||||    
21367750 cataagttctcccaaacagtc 21367770  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 139 - 305
Target Start/End: Original strand, 1816506 - 1816675
Alignment:
139 ttatcatataagcgcttatggataagctattttt-ataacacaacataaaattaagtcat--tgtttttgtataataaataacttgttttcataagctat 235  Q
    |||||||||||| ||| ||| |||| |||||||| |||| | || ||||||| ||||||   ||||||||||||| | |||| |||||||||||||||||    
1816506 ttatcatataagagctaatgtataaactattttttataataaaagataaaataaagtcaaactgtttttgtataagatataagttgttttcataagctat 1816605  T
236 cctggagagcttatgaaaatgagtttaaaacagggtatgaacatgtcatgaactgttttcataagttctc 305  Q
     ||||||||||||| ||||| || | |||||||  |||||| ||||||| |  | |||||||| ||||||    
1816606 actggagagcttatcaaaataagctgaaaacagcctatgaaaatgtcataagttattttcatatgttctc 1816675  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 95 - 329
Target Start/End: Complemental strand, 30574100 - 30573868
Alignment:
95 tttggataaataacttaatttgcaacttacatcataagaagtgcttatcat-ataagcgcttatggataagctatttttataacacaacataaaattaag 193  Q
    |||||||||| | | ||||||||| |||| |||||||| | |   |||||| ||||||||||||| ||||||||||| ||||| |  | ||||||| |||    
30574100 tttggataaacaccataatttgcagcttatatcataagcatt---tatcatgataagcgcttatgtataagctatttctataaaa--agataaaataaag 30574006  T
194 tca--ttgtttttgtataataaataacttgttttcataagctatcctggagagcttatgaaaatgagtttaaaacagggtatgaacatgtcatgaactgt 291  Q
    | |  || ||||| ||||||  |||   ||||||||||||||||| ||||||||| ||||| || || | |||||||  |||||||||| ||| |  |||    
30574005 ttaagttttttttttataatctatatgatgttttcataagctatcttggagagctgatgaacataagctgaaaacagcttatgaacatgccataatttgt 30573906  T
292 tttcataagttctctcaaacagtctaacaagtgcttat 329  Q
    |||||||||||||| ||||||  || ||||||||||||    
30573905 tttcataagttctcacaaacaaactcacaagtgcttat 30573868  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 222 - 364
Target Start/End: Original strand, 45541580 - 45541724
Alignment:
222 ttttcataagctatcctggagagcttatgaaaatgagtttaaaacagggtatgaacatgtcatgaactgttttcataagttctctcaaacagtctaacaa 321  Q
    ||||||||||||||| |||| | ||||||| ||| |  | |||||||  |||||||||||||| | |||||||||||||||||   ||||||||| ||||    
45541580 ttttcataagctatcttggataacttatgagaataacctgaaaacagcttatgaacatgtcataagctgttttcataagttcttctaaacagtcttacaa 45541679  T
322 gtgcttatacaa--gaatagcctcaaataagtcaatccaaacagg 364  Q
    ||| |||||| |   ||||  ||||||||||||||||||||||||    
45541680 gtgtttataccattaaataagctcaaataagtcaatccaaacagg 45541724  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 155 - 284
Target Start/End: Original strand, 24785145 - 24785276
Alignment:
155 tatggataagctatttttataacacaacataaaattaagtcatt--gtttttgtataataaataacttgttttcataagctatcctggagagcttatgaa 252  Q
    |||| |||| |||||| || | ||||| ||||||| |||||| |  |||||||||||||  ||||| ||||||||||||||||||| ||||||||||| |    
24785145 tatgaataacctatttctaaatcacaagataaaataaagtcaatctgtttttgtataatctataacgtgttttcataagctatcctcgagagcttatgta 24785244  T
253 aatgagtttaaaacagggtatgaacatgtcat 284  Q
    ||| || | ||||||   ||||||||||||||    
24785245 aataagctaaaaacaacttatgaacatgtcat 24785276  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 214 - 325
Target Start/End: Complemental strand, 14548790 - 14548679
Alignment:
214 ataacttgttttcataagctatcctggagagcttatgaaaatgagtttaaaacagggtatgaacatgtcatgaactgttttcataagttctctcaaacag 313  Q
    |||| ||||||||||||| ||| |||||||||||||| |||| || | |||||||  ||| || |||||||    |||||||||||| ||||||||||||    
14548790 ataagttgttttcataagttattctggagagcttatggaaataagctgaaaacagcctattaaaatgtcatacgttgttttcataagctctctcaaacag 14548691  T
314 tctaacaagtgc 325  Q
    ||| ||||||||    
14548690 tctcacaagtgc 14548679  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 147 - 329
Target Start/End: Complemental strand, 20192744 - 20192560
Alignment:
147 taagcgcttatggataagctatttttataacacaacataaaattaagtcatt--gtttttgtataataaataacttgttttcataagctatcctggagag 244  Q
    |||| ||||||| ||||||||||| ||||||| || ||||||| ||||||    |||||  ||||||  ||||  ||||||  |||  ||| | ||||||    
20192744 taagtgcttatgtataagctatttatataacaaaagataaaataaagtcaaacagttttcatataatctataagctgtttttgtaacttattcgggagag 20192645  T
245 cttatgaaaatgagtttaaaacagggtatgaacatgtcatgaactgttttcataagttctctcaaacagtctaacaagtgcttat 329  Q
    |||||| ||||||||| |||||||  |||| ||||||||| | ||||||  ||||| ||||||| ||||| ||| ||||||||||    
20192644 cttatggaaatgagttgaaaacagcttatggacatgtcataagctgtttctataagctctctcatacagtgtaagaagtgcttat 20192560  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 220 - 329
Target Start/End: Original strand, 37273141 - 37273250
Alignment:
220 tgttttcataagctatcctggagagcttatgaaaatgagtttaaaacagggtatgaacatgtcatgaactgttttcataagttctctcaaacagtctaac 319  Q
    ||||||||||||||||| |||||| |||||| |||| |||| ||||||   |||| ||||||||| |  ||||| |||||| |||| |||||||||| ||    
37273141 tgttttcataagctatcttggagaacttatggaaataagttgaaaacaacttatggacatgtcataagttgtttccataagctctcccaaacagtctcac 37273240  T
320 aagtgcttat 329  Q
     |||||||||    
37273241 cagtgcttat 37273250  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #10
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 151 - 329
Target Start/End: Complemental strand, 49465797 - 49465619
Alignment:
151 cgcttatggataagctatttttataacacaacataaaattaagtcattgttttt-gtataa-taaataacttgttttcataagctatcctggagagctta 248  Q
    ||||||||  |||||||||||||||||| || ||||||| |||| | | ||||| |||||  |||||   ||||||||||||||||| ||||||| ||||    
49465797 cgcttatgtgtaagctatttttataacaaaagataaaataaagttaatttttttcgtatagctaaatg--ttgttttcataagctatactggagaactta 49465700  T
249 tgaaaatgagtttaaaacagggtatgaacatgtcatgaactgttttcataagttctctcaaacagtctaacaagtgcttat 329  Q
    || |||| || |||||| |    |||||||||| || | ||||||||||||||||||  ||||| | | ||||||||||||    
49465699 tggaaataagcttaaaaaacctaatgaacatgtaataagctgttttcataagttctccgaaacaatatcacaagtgcttat 49465619  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #11
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 227 - 316
Target Start/End: Original strand, 50952347 - 50952436
Alignment:
227 ataagctatcctggagagcttatgaaaatgagtttaaaacagggtatgaacatgtcatgaactgttttcataagttctctcaaacagtct 316  Q
    |||| ||||| ||||||||||||| |||| || |||||||||  |||||||||||||| | |||||||| || |||||||| ||||||||    
50952347 ataaactatcttggagagcttatggaaataagcttaaaacagtttatgaacatgtcataagctgttttcgtacgttctctcgaacagtct 50952436  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #12
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 195 - 316
Target Start/End: Complemental strand, 54837122 - 54837001
Alignment:
195 cattgtttttgtataataaataacttgttttcataagctatcctggagagcttatgaaaatgagtttaaaacagggtatgaacatgtcatgaactgtttt 294  Q
    ||||||||||||||||    ||| || ||||||||||||||| |||| ||||||| ||||| ||   |||||| | |||||||||||||| | |||||||    
54837122 cattgtttttgtataaactgtaagttattttcataagctatcttggacagcttataaaaataagcggaaaacaagttatgaacatgtcataagctgtttt 54837023  T
295 cataagttctctcaaacagtct 316  Q
    ||||| ||||  ||||||||||    
54837022 cataaattcttccaaacagtct 54837001  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #13
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 214 - 321
Target Start/End: Complemental strand, 18405900 - 18405792
Alignment:
214 ataacttgttttcataagctatcctggagagcttatgaaaatgagtttaaaacagggtatgaaca-tgtcatgaactgttttcataagttctctcaaaca 312  Q
    |||| |||||||||||||||||| |||||| ||||||||| | || || ||| ||  |||||| | |||| |||||||||||||||||||||  ||||||    
18405900 ataagttgttttcataagctatcttggagaacttatgaaattaagcttgaaaaagattatgaaaagtgtcgtgaactgttttcataagttcttgcaaaca 18405801  T
313 gtctaacaa 321  Q
    |||| ||||    
18405800 gtctcacaa 18405792  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #14
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 214 - 284
Target Start/End: Complemental strand, 3044328 - 3044258
Alignment:
214 ataacttgttttcataagctatcctggagagcttatgaaaatgagtttaaaacagggtatgaacatgtcat 284  Q
    ||||| ||||||| || |||| |||||||||||||||||||| |||| |||||||  ||||||||||||||    
3044328 ataacctgttttcttatgctaacctggagagcttatgaaaataagttgaaaacagcttatgaacatgtcat 3044258  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #15
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 230 - 361
Target Start/End: Original strand, 24281064 - 24281197
Alignment:
230 agctatcctggagagcttatgaaaatgagtttaaaacagggtatgaacatgtcatgaactgttttcataagttctctcaaacagtctaacaagtgcttat 329  Q
    ||||||| |||||||||||||||| | |||| ||||||   |||| | || |||| |  |||||||||||| ||||||||||| ||  ||||||||||||    
24281064 agctatcatggagagcttatgaaagtaagttgaaaacaacttatggagatatcataagttgttttcataagctctctcaaacaatcacacaagtgcttat 24281163  T
330 acaag--aatagcctcaaataagtcaatccaaac 361  Q
    || ||   |||| |||||||||||||||| ||||    
24281164 accagtagatagactcaaataagtcaatctaaac 24281197  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #16
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 220 - 300
Target Start/End: Complemental strand, 39602273 - 39602193
Alignment:
220 tgttttcataagctatcctggagagcttatgaaaatgagtttaaaacagggtatgaacatgtcatgaactgttttcataag 300  Q
    ||||||||||||||||| | |||| ||||||||||| |||| ||||||   |||||||||||||| | |||| ||||||||    
39602273 tgttttcataagctatctttgagaacttatgaaaataagttgaaaacaatttatgaacatgtcataagctgtcttcataag 39602193  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #17
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 214 - 321
Target Start/End: Original strand, 39980730 - 39980838
Alignment:
214 ataacttgttttcataagctatcctggagagcttatgaaaatgagtttaaaacagggtatgaa-catgtcatgaactgttttcataagttctctcaaaca 312  Q
    |||| ||||||| |||||||||  |||||| ||||||||||| |||| |||| ||  |||||| |  ||||| | ||||||||||||||||||| |||||    
39980730 ataagttgtttttataagctatattggagaacttatgaaaataagttgaaaaaagcttatgaaaccagtcataagctgttttcataagttctcttaaaca 39980829  T
313 gtctaacaa 321  Q
    |||| ||||    
39980830 gtctcacaa 39980838  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #18
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 271 - 364
Target Start/End: Complemental strand, 44014810 - 44014715
Alignment:
271 tatgaacatgtcatgaactgttttcataagttctctcaaacagtctaacaagtgcttatacaag--aatagcctcaaataagtcaatccaaacagg 364  Q
    |||||||| ||||| | ||||||||||||||| ||||||||||||| ||||||| |||| | ||   |||  |||||||||| |||||||||||||    
44014810 tatgaacaggtcataagctgttttcataagttttctcaaacagtctcacaagtgtttatgctagtagataaactcaaataagccaatccaaacagg 44014715  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #19
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 289 - 329
Target Start/End: Original strand, 50211811 - 50211851
Alignment:
289 tgttttcataagttctctcaaacagtctaacaagtgcttat 329  Q
    |||||||||||||||||||||||||||| ||||||||||||    
50211811 tgttttcataagttctctcaaacagtcttacaagtgcttat 50211851  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #20
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 273 - 336
Target Start/End: Complemental strand, 20195043 - 20194980
Alignment:
273 tgaacatgtcatgaactgttttcataagttctctcaaacagtctaacaagtgcttatacaagaa 336  Q
    |||| ||||||| ||||||||||||||| |||| |||||||||| |||| ||||||| ||||||    
20195043 tgaatatgtcataaactgttttcataagctctcacaaacagtctcacaactgcttatgcaagaa 20194980  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #21
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 200 - 255
Target Start/End: Original strand, 22203417 - 22203472
Alignment:
200 tttttgtataataaataacttgttttcataagctatcctggagagcttatgaaaat 255  Q
    ||||||||||||  |||| |||||||||||||||||| |||||| |||||||||||    
22203417 tttttgtataatctataagttgttttcataagctatcttggagaacttatgaaaat 22203472  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #22
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 223 - 322
Target Start/End: Complemental strand, 27896230 - 27896131
Alignment:
223 tttcataagctatcctggagagcttatgaaaatgagtttaaaacagggtatgaacatgtcatgaactgttttcataagttctctcaaacagtctaacaag 322  Q
    |||||||||||||| ||||||| || ||||||| || | |  |||   ||||||| |||||||| |||||||||||| |||||  |||||||||||||||    
27896230 tttcataagctatcttggagagtttttgaaaataagctgacgacaatttatgaacttgtcatgagctgttttcataaattctcctaaacagtctaacaag 27896131  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #23
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 223 - 333
Target Start/End: Complemental strand, 2152238 - 2152128
Alignment:
223 tttcataagctatcctggagagcttatgaaaatgagtttaaaacagggtatgaacatgtcatgaactgttttcataagttctctcaaacagtctaacaag 322  Q
    |||||||| ||||||| ||||||||||  |||  |||| |||||||  || ||||||||||| |  |||||||||||  | ||||||  ||||| |||||    
2152238 tttcataaactatccttgagagcttatagaaacaagttgaaaacagcttacgaacatgtcataagttgttttcataaaatatctcaattagtctcacaag 2152139  T
323 tgcttatacaa 333  Q
    |||||||||||    
2152138 tgcttatacaa 2152128  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #24
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 222 - 316
Target Start/End: Original strand, 21574499 - 21574593
Alignment:
222 ttttcataagctatcctggagagcttatgaaaatgagtttaaaacagggtatgaacatgtcatgaactgttttcataagttctctcaaacagtct 316  Q
    |||| |||||||| | ||||||||||||| |||| || | ||| |||  |||||||||||||| |  |||||||||||| |||| ||||||||||    
21574499 tttttataagctaacatggagagcttatggaaataagctaaaagcagcttatgaacatgtcataagttgttttcataagctctcccaaacagtct 21574593  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #25
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 220 - 326
Target Start/End: Original strand, 24624217 - 24624323
Alignment:
220 tgttttcataagctatcctggagagcttatgaaaatgagtttaaaacagggtatgaacatgtcatgaactgttttcataagttctctcaaacagtctaac 319  Q
    |||||||||| |||||||| || | ||||||  ||| || | |||||||  |||| ||||||||| | ||||||||||||| |||  |||||||||| ||    
24624217 tgttttcataggctatcctagaaatcttatgttaataagctgaaaacagtttatggacatgtcataagctgttttcataagctcttccaaacagtcttac 24624316  T
320 aagtgct 326  Q
    |||||||    
24624317 aagtgct 24624323  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #26
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 214 - 316
Target Start/End: Complemental strand, 40881017 - 40880915
Alignment:
214 ataacttgttttcataagctatcctggagagcttatgaaaatgagtttaaaacagggtatgaacatgtcatgaactgttttcataagttctctcaaacag 313  Q
    |||| |||||||||||| ||||||| ||||  |||| ||||| |||||||||||   || |  |||||||| |  |||||||||||| ||||||||||||    
40881017 ataaattgttttcataaactatcctagagaagttataaaaataagtttaaaacaacttacggtcatgtcataagttgttttcataagctctctcaaacag 40880918  T
314 tct 316  Q
    |||    
40880917 tct 40880915  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #27
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 230 - 324
Target Start/End: Original strand, 47513670 - 47513764
Alignment:
230 agctatcctggagagcttatgaaaatgagtttaaaacagggtatgaacatgtcatgaactgttttcataagttctctcaaacagtctaacaagtg 324  Q
    ||||||| |||||||||||||||||| | || ||||||   ||||||| |||||| |  ||||||||||||| ||| | |||||||| |||||||    
47513670 agctatcttggagagcttatgaaaataaattgaaaacaacttatgaacgtgtcataacttgttttcataagtcctcccgaacagtctcacaagtg 47513764  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #28
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 245 - 302
Target Start/End: Original strand, 5391911 - 5391968
Alignment:
245 cttatgaaaatgagtttaaaacagggtatgaacatgtcatgaactgttttcataagtt 302  Q
    ||||||||||| |||| |||||||  |||||||||||||| | |||||||||||||||    
5391911 cttatgaaaataagttgaaaacagcttatgaacatgtcataagctgttttcataagtt 5391968  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #29
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 235 - 284
Target Start/End: Original strand, 25925764 - 25925813
Alignment:
235 tcctggagagcttatgaaaatgagtttaaaacagggtatgaacatgtcat 284  Q
    ||||||||||||||||||||| |||| |||||||  ||||||||||||||    
25925764 tcctggagagcttatgaaaataagttgaaaacagcttatgaacatgtcat 25925813  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #30
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 140 - 196
Target Start/End: Complemental strand, 905115 - 905059
Alignment:
140 tatcatataagcgcttatggataagctatttttataacacaacataaaattaagtca 196  Q
    ||||||||||||||||| | ||||||||||| ||||||| || ||||||| ||||||    
905115 tatcatataagcgcttaagtataagctatttctataacaaaagataaaataaagtca 905059  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #31
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 220 - 312
Target Start/End: Complemental strand, 20467249 - 20467157
Alignment:
220 tgttttcataagctatcctggagagcttatgaaaatgagtttaaaacagggtatgaacatgtcatgaactgttttcataagttctctcaaaca 312  Q
    |||||||||||| |||||| | |||||| | ||||| ||   |||||||  |||||||||||||| |||||||| ||| || |||||||||||    
20467249 tgttttcataagatatcctagcgagcttgtcaaaattagccgaaaacagcatatgaacatgtcataaactgtttccattagctctctcaaaca 20467157  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #32
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 220 - 284
Target Start/End: Original strand, 20669179 - 20669243
Alignment:
220 tgttttcataagctatcctggagagcttatgaaaatgagtttaaaacagggtatgaacatgtcat 284  Q
    ||||||||||||||||| ||||||||||||| |||| ||   |||||||  ||||||||||||||    
20669179 tgttttcataagctatcttggagagcttatgtaaataagcggaaaacagcttatgaacatgtcat 20669243  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #33
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 220 - 260
Target Start/End: Complemental strand, 24158566 - 24158526
Alignment:
220 tgttttcataagctatcctggagagcttatgaaaatgagtt 260  Q
    ||||||||||||||||||||||||||||||| |||| ||||    
24158566 tgttttcataagctatcctggagagcttatggaaataagtt 24158526  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #34
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 133 - 189
Target Start/End: Original strand, 25964360 - 25964416
Alignment:
133 aagtgcttatcatataagcgcttatggataagctatttttataacacaacataaaat 189  Q
    ||||||||||||||||||  ||| || ||||||||||||||||||| || |||||||    
25964360 aagtgcttatcatataagttcttttgtataagctatttttataacaaaagataaaat 25964416  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #35
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 160 - 325
Target Start/End: Complemental strand, 36646507 - 36646340
Alignment:
160 ataagctatttttataacacaacataaaattaagtc--attgtttttgtataataaataacttgttttcataagctatcctggagagcttatgaaaatga 257  Q
    ||||||||||| ||| ||| || ||||||| ||||   ||||||||  |||||   ||||||||||||||||||||||||| ||||| ||||  |||| |    
36646507 ataagctatttctatgacaaaagataaaataaagtataattgttttcatataagttataacttgttttcataagctatcctagagagtttatagaaataa 36646408  T
258 gtttaaaacagggtatgaacatgtcatgaactgttttcataagttctctcaaacagtctaacaagtgc 325  Q
    | | |||||||  |||| ||||| ||| |   |||| |||||| |||| |||| ||||| ||||||||    
36646407 gatgaaaacagcttatggacatgccataagtggtttccataagctctcccaaatagtcttacaagtgc 36646340  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #36
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 220 - 284
Target Start/End: Original strand, 40665436 - 40665500
Alignment:
220 tgttttcataagctatcctggagagcttatgaaaatgagtttaaaacagggtatgaacatgtcat 284  Q
    |||||||||||| |||| |||||||||||| ||||| || | |||||||  ||||||||||||||    
40665436 tgttttcataagttatcttggagagcttataaaaataagctgaaaacagcttatgaacatgtcat 40665500  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #37
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 136 - 196
Target Start/End: Complemental strand, 41029000 - 41028940
Alignment:
136 tgcttatcatataagcgcttatggataagctatttttataacacaacataaaattaagtca 196  Q
    ||||||||||||||| ||||||| ||||||||||| ||||||| || | ||||| ||||||    
41029000 tgcttatcatataagtgcttatgtataagctatttctataacaaaagaaaaaataaagtca 41028940  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #38
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 222 - 265
Target Start/End: Original strand, 2825156 - 2825199
Alignment:
222 ttttcataagctatcctggagagcttatgaaaatgagtttaaaa 265  Q
    ||||||||||||||| |||||||||||||||||| || ||||||    
2825156 ttttcataagctatcttggagagcttatgaaaataagcttaaaa 2825199  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #39
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 139 - 178
Target Start/End: Complemental strand, 16790502 - 16790463
Alignment:
139 ttatcatataagcgcttatggataagctatttttataaca 178  Q
    |||||||||||| ||||||| |||||||||||||||||||    
16790502 ttatcatataagtgcttatgtataagctatttttataaca 16790463  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #40
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 141 - 196
Target Start/End: Original strand, 34958254 - 34958309
Alignment:
141 atcatataagcgcttatggataagctatttttataacacaacataaaattaagtca 196  Q
    ||||||||||| |||||| |||| |||||| |||||||||| ||||||| ||||||    
34958254 atcatataagcacttatgaataaactatttctataacacaagataaaataaagtca 34958309  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #41
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 278 - 329
Target Start/End: Original strand, 50760656 - 50760707
Alignment:
278 atgtcatgaactgttttcataagttctctcaaacagtctaacaagtgcttat 329  Q
    ||||||||||| |||||||||||||||||||| | || | ||||||||||||    
50760656 atgtcatgaacagttttcataagttctctcaagcggtgtcacaagtgcttat 50760707  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #42
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 220 - 250
Target Start/End: Complemental strand, 24887346 - 24887316
Alignment:
220 tgttttcataagctatcctggagagcttatg 250  Q
    |||||||||||||||||||||||||||||||    
24887346 tgttttcataagctatcctggagagcttatg 24887316  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #43
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 289 - 363
Target Start/End: Complemental strand, 25182981 - 25182908
Alignment:
289 tgttttcataagttctctcaaacagtctaacaagtgcttatacaagaatagcctcaaataagtcaatccaaacag 363  Q
    |||||||||||| ||||||||||||||| |||||| ||||||  ||  ||  ||||||||||||| |||||||||    
25182981 tgttttcataagctctctcaaacagtctcacaagttcttatagtag-gtaagctcaaataagtcactccaaacag 25182908  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #44
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 271 - 329
Target Start/End: Original strand, 25258830 - 25258888
Alignment:
271 tatgaacatgtcatgaactgttttcataagttctctcaaacagtctaacaagtgcttat 329  Q
    |||| ||||||||| |||| ||||||||||||| |||||| ||||| |||||| |||||    
25258830 tatgcacatgtcataaactcttttcataagttcactcaaaaagtctcacaagtacttat 25258888  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #45
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 240 - 314
Target Start/End: Complemental strand, 33880599 - 33880526
Alignment:
240 gagagcttatgaaaatgagtttaaaacagggtatgaacatgtcatgaactgttttcataagttctctcaaacagt 314  Q
    ||||||||| | |||| || |||||||||  |||| |||| |||||| |||||||||||||||||| ||||||||    
33880599 gagagcttaggcaaataagattaaaacagcttatggacat-tcatgatctgttttcataagttctcccaaacagt 33880526  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #46
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 288 - 363
Target Start/End: Complemental strand, 47904075 - 47903998
Alignment:
288 ctgttttcataagttctctcaaacagtctaacaagtgcttatacaaga--atagcctcaaataagtcaatccaaacag 363  Q
    |||||||||||||||||| |||||||| | ||| | |||||||  |||  |||  |||||||||||||||||||||||    
47904075 ctgttttcataagttctcccaaacagtgtcacaggagcttatatcagaggataaactcaaataagtcaatccaaacag 47903998  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #47
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 291 - 329
Target Start/End: Original strand, 50015964 - 50016002
Alignment:
291 ttttcataagttctctcaaacagtctaacaagtgcttat 329  Q
    |||||||||||||||||||||||||| ||||||| ||||    
50015964 ttttcataagttctctcaaacagtctcacaagtgtttat 50016002  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #48
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 240 - 314
Target Start/End: Original strand, 53952075 - 53952149
Alignment:
240 gagagcttatgaaaatgagtttaaaacagggtatgaacatgtcatgaactgttttcataagttctctcaaacagt 314  Q
    ||||| |||||||||| || | |||||||   |||||||||| || | ||||||||||||||||||| |||||||    
53952075 gagagtttatgaaaataagctgaaaacagctcatgaacatgttatcagctgttttcataagttctcttaaacagt 53952149  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #49
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 276 - 329
Target Start/End: Complemental strand, 2413686 - 2413633
Alignment:
276 acatgtcatgaactgttttcataagttctctcaaacagtctaacaagtgcttat 329  Q
    ||||||||||| | ||||||||||| |||||||||||| || ||||||| ||||    
2413686 acatgtcatgagccgttttcataagctctctcaaacagacttacaagtgattat 2413633  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #50
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 220 - 321
Target Start/End: Complemental strand, 3845625 - 3845524
Alignment:
220 tgttttcataagctatcctggagagcttatgaaaatgagtttaaaacagggtatgaacatgtcatgaactgttttcataagttctctcaaacagtctaac 319  Q
    |||||||||||| |||| |||||| ||||||||||| || | |||| ||  ||| || ||||||| | |||| |||| | ||||| ||||||||||| ||    
3845625 tgttttcataagttatcttggagaacttatgaaaataagctgaaaaaagattataaaaatgtcataatctgtcttcagatgttctatcaaacagtctcac 3845526  T
320 aa 321  Q
    ||    
3845525 aa 3845524  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #51
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 341 - 374
Target Start/End: Complemental strand, 16072981 - 16072948
Alignment:
341 ctcaaataagtcaatccaaacaggtcgtaagtgt 374  Q
    |||||||||||||||||||||||||| |||||||    
16072981 ctcaaataagtcaatccaaacaggtcctaagtgt 16072948  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #52
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 227 - 316
Target Start/End: Complemental strand, 23808120 - 23808031
Alignment:
227 ataagctatcctggagagcttatgaaaatgagtttaaaacagggtatgaacatgtcatgaactgttttcataagttctctcaaacagtct 316  Q
    |||||||||| ||||||| |||||||||| || | ||||||   | |||||||||||| | ||| ||||||||||| || ||||| ||||    
23808120 ataagctatcttggagagtttatgaaaataagatgaaaacaatttgtgaacatgtcataagctgctttcataagttttcccaaaccgtct 23808031  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #53
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 220 - 265
Target Start/End: Original strand, 24280718 - 24280763
Alignment:
220 tgttttcataagctatcctggagagcttatgaaaatgagtttaaaa 265  Q
    |||| |||||||||||| |||||||||||||||||| |||| ||||    
24280718 tgttgtcataagctatcatggagagcttatgaaaataagttgaaaa 24280763  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #54
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 220 - 249
Target Start/End: Complemental strand, 44284143 - 44284114
Alignment:
220 tgttttcataagctatcctggagagcttat 249  Q
    ||||||||||||||||||||||||||||||    
44284143 tgttttcataagctatcctggagagcttat 44284114  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #55
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 220 - 317
Target Start/End: Complemental strand, 50600241 - 50600144
Alignment:
220 tgttttcataagctatcctggagagcttatgaaaatgagtttaaaacagggtatgaacatgtcatgaactgttttcataagttctctcaaacagtcta 317  Q
    ||||||||| ||||||  |||||| ||||||||||| || | |||||||    || |||||||||||  |||||| |||||||||  |||||||||||    
50600241 tgttttcatcagctatattggagaacttatgaaaataagctgaaaacagctcgtggacatgtcatgagttgtttttataagttcttccaaacagtcta 50600144  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #56
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 219 - 329
Target Start/End: Complemental strand, 52323960 - 52323848
Alignment:
219 ttgttttcataagctatcctggagagctta--tgaaaatgagtttaaaacagggtatgaacatgtcatgaactgttttcataagttctctcaaacagtct 316  Q
    ||||||| |||||||||| |||||||||||  || |||| |||| |||||||  |||| || |||||| || | |||  ||||| |||| ||||||||||    
52323960 ttgttttgataagctatcttggagagcttatgtggaaataagttgaaaacagcttatggacgtgtcataaattatttcaataagctctcacaaacagtct 52323861  T
317 aacaagtgcttat 329  Q
      |||||||||||    
52323860 tgcaagtgcttat 52323848  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #57
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 219 - 255
Target Start/End: Original strand, 8933793 - 8933829
Alignment:
219 ttgttttcataagctatcctggagagcttatgaaaat 255  Q
    ||||||||||||| |||| ||||||||||||||||||    
8933793 ttgttttcataagttatcttggagagcttatgaaaat 8933829  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #58
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 214 - 305
Target Start/End: Complemental strand, 24085407 - 24085315
Alignment:
214 ataacttgttttcataagctatcctggagagcttatgaaaatgagtttaaaacagggtatgaaca-tgtcatgaactgttttcataagttctc 305  Q
    |||| |||||||  ||||||||| |||||| ||| ||||||| || | ||||||| ||||||||| |  ||| | ||||||||||||||||||    
24085407 ataatttgtttttgtaagctatcttggagaacttgtgaaaataagctgaaaacagcgtatgaacagtaccataagctgttttcataagttctc 24085315  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #59
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 246 - 321
Target Start/End: Complemental strand, 31365225 - 31365149
Alignment:
246 ttatgaaaatgagtttaaaacagggtatgaacat-gtcatgaactgttttcataagttctctcaaacagtctaacaa 321  Q
    ||||||||||||||| |||| ||  |||||| || ||||| | ||| |||||||||||||| |||||||||| ||||    
31365225 ttatgaaaatgagttgaaaaaagcttatgaaaattgtcataagctgctttcataagttctcccaaacagtctcacaa 31365149  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #60
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 289 - 329
Target Start/End: Complemental strand, 34707490 - 34707450
Alignment:
289 tgttttcataagttctctcaaacagtctaacaagtgcttat 329  Q
    |||||||| ||||||||||||||||||| ||||| ||||||    
34707490 tgttttcaaaagttctctcaaacagtctcacaagcgcttat 34707450  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #61
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 273 - 305
Target Start/End: Complemental strand, 36769981 - 36769949
Alignment:
273 tgaacatgtcatgaactgttttcataagttctc 305  Q
    |||||||||||||| ||||||||||||||||||    
36769981 tgaacatgtcatgagctgttttcataagttctc 36769949  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #62
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 136 - 196
Target Start/End: Complemental strand, 44374793 - 44374733
Alignment:
136 tgcttatcatataagcgcttatggataagctatttttataacacaacataaaattaagtca 196  Q
    ||||||||||||||| ||||||| ||||||||| | | ||||| || ||||||| ||||||    
44374793 tgcttatcatataagtgcttatgtataagctatatctttaacaaaagataaaataaagtca 44374733  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #63
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 220 - 260
Target Start/End: Complemental strand, 45535281 - 45535241
Alignment:
220 tgttttcataagctatcctggagagcttatgaaaatgagtt 260  Q
    |||||||||||||||| |||||||| |||||||||| ||||    
45535281 tgttttcataagctatactggagagtttatgaaaataagtt 45535241  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 57; Significance: 1e-23; HSPs: 61)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 145 - 314
Target Start/End: Complemental strand, 42215446 - 42215275
Alignment:
145 tataagcgcttatggataagctatttttataacacaacataaaattaagtcat--tgtttttgtataataaataacttgttttcataagctatcctggag 242  Q
    |||| |||||||||||| | |||||| || ||||  | ||||||| ||||||   ||||||||||||||  ||||| | |||||||| ||||||||||||    
42215446 tatatgcgcttatggatgaactatttctacaacatgagataaaataaagtcaaactgtttttgtataatctataacctattttcatatgctatcctggag 42215347  T
243 agcttatgaaaatgagtttaaaacagggtatgaacatgtcatgaactgttttcataagttctctcaaacagt 314  Q
    |||||||| |||| || | |||||||  |||||||| ||||| | |||||||||| ||||||| ||||||||    
42215346 agcttatgtaaataagctgaaaacagcttatgaacaagtcataagctgttttcattagttctcccaaacagt 42215275  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 214 - 330
Target Start/End: Complemental strand, 39551278 - 39551162
Alignment:
214 ataacttgttttcataagctatcctggagagcttatgaaaatgagtttaaaacagggtatgaacatgtcatgaactgttttcataagttctctcaaacag 313  Q
    |||| ||||||||||||||| ||||||||||||||| ||||| |||| |||||||  | || ||||||||| |  ||||| ||||| ||||| |||||||    
39551278 ataagttgttttcataagctttcctggagagcttataaaaataagttaaaaacagcttttggacatgtcataagttgtttccataaattctcccaaacag 39551179  T
314 tctaacaagtgcttata 330  Q
    | | |||| ||||||||    
39551178 tttcacaaatgcttata 39551162  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 219 - 317
Target Start/End: Original strand, 12851182 - 12851280
Alignment:
219 ttgttttcataagctatcctggagagcttatgaaaatgagtttaaaacagggtatgaacatgtcatgaactgttttcataagttctctcaaacagtcta 317  Q
    ||||||||||||||| |||| |||||||||||||||| ||   ||||||   ||||||||||| || | ||||||||||||||| || |||||||||||    
12851182 ttgttttcataagctttccttgagagcttatgaaaataagccgaaaacatcttatgaacatgttataagctgttttcataagttttcccaaacagtcta 12851280  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 220 - 329
Target Start/End: Complemental strand, 11569520 - 11569411
Alignment:
220 tgttttcataagctatcctggagagcttatgaaaatgagtttaaaacagggtatgaacatgtcatgaactgttttcataagttctctcaaacagtctaac 319  Q
    ||||||||||||||||| ||||||| || ||||||| || | ||||||   |||| ||||||||| | |||||| |||||| ||||| ||||||||| ||    
11569520 tgttttcataagctatcatggagagattttgaaaataagctgaaaacaacttatgtacatgtcataagctgtttccataagctctcttaaacagtctcac 11569421  T
320 aagtgcttat 329  Q
    ||||| ||||    
11569420 aagtggttat 11569411  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 220 - 284
Target Start/End: Original strand, 20672757 - 20672821
Alignment:
220 tgttttcataagctatcctggagagcttatgaaaatgagtttaaaacagggtatgaacatgtcat 284  Q
    |||||| ||||||||||||||||||||||||||||| || | |||||||  ||||||||||||||    
20672757 tgtttttataagctatcctggagagcttatgaaaataagctgaaaacagcttatgaacatgtcat 20672821  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 219 - 305
Target Start/End: Complemental strand, 26473816 - 26473730
Alignment:
219 ttgttttcataagctatcctggagagcttatgaaaatgagtttaaaacagggtatgaacatgtcatgaactgttttcataagttctc 305  Q
    |||||||||||||||||||| |||||||||||||||| |||| |||  ||  |||  ||||||||| | ||||||||||||| ||||    
26473816 ttgttttcataagctatcctagagagcttatgaaaataagttaaaactagcttatagacatgtcataagctgttttcataagctctc 26473730  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #7
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 220 - 314
Target Start/End: Original strand, 30389106 - 30389200
Alignment:
220 tgttttcataagctatcctggagagcttatgaaaatgagtttaaaacagggtatgaacatgtcatgaactgttttcataagttctctcaaacagt 314  Q
    |||||||||||||| |||| |||| ||||||||||| || | ||||||   |||||||||||||| | || |||||||| | |||||||||||||    
30389106 tgttttcataagctttcctagagaacttatgaaaataagctgaaaacaacttatgaacatgtcattagctattttcatatgctctctcaaacagt 30389200  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #8
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 219 - 316
Target Start/End: Complemental strand, 7918510 - 7918413
Alignment:
219 ttgttttcataagctatcctggagagcttatgaaaatgagtttaaaacagggtatgaacatgtcatgaactgttttcataagttctctcaaacagtct 316  Q
    |||||||| ||||||||| ||||||||||||  |||| ||||  ||||||  |||||||||||| | |  |||||||||||| |||| ||||||||||    
7918510 ttgttttcgtaagctatcttggagagcttattgaaataagttggaaacagcttatgaacatgtcttaagttgttttcataagctctcccaaacagtct 7918413  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #9
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 146 - 233
Target Start/End: Original strand, 926418 - 926508
Alignment:
146 ataagcgcttatggataagctatttttataacacaacataaaattaagtc---attgtttttgtataataaataacttgttttcataagct 233  Q
    |||||||| |||| ||||||||||| |||||||||| ||||||| |||||   | ||||||||||| ||  |||| |||||||||||||||    
926418 ataagcgcatatgaataagctatttctataacacaagataaaataaagtcaaaactgtttttgtattatctataagttgttttcataagct 926508  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #10
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 221 - 265
Target Start/End: Original strand, 1433556 - 1433600
Alignment:
221 gttttcataagctatcctggagagcttatgaaaatgagtttaaaa 265  Q
    ||||||||||||||||||||||||||||||||||| |||| ||||    
1433556 gttttcataagctatcctggagagcttatgaaaataagttgaaaa 1433600  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #11
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 214 - 317
Target Start/End: Complemental strand, 9956883 - 9956779
Alignment:
214 ataacttgttttcataagctatcctggagagcttatgaaaatgagtttaaaacagggtatgaac-atgtcatgaactgttttcataagttctctcaaaca 312  Q
    |||| |||||||||||| ||||| |||||| ||||||||||| || | |||||    ||||||| ||| ||| |||| |||||||||||||||||||||     
9956883 ataagttgttttcataatctatcttggagaacttatgaaaataagctgaaaactacttatgaacaatgccataaactattttcataagttctctcaaacg 9956784  T
313 gtcta 317  Q
    |||||    
9956783 gtcta 9956779  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #12
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 271 - 364
Target Start/End: Original strand, 16162818 - 16162913
Alignment:
271 tatgaacatgtcatgaactgttttcataagttctctcaaacagtctaacaagtgcttatacaag--aatagcctcaaataagtcaatccaaacagg 364  Q
    |||||||| ||||| | ||||||||||||||| ||||||||||||| ||||||| |||| | ||   |||  |||||||||| |||||||||||||    
16162818 tatgaacaggtcataagctgttttcataagttttctcaaacagtctcacaagtgtttatgctagtagataaactcaaataagccaatccaaacagg 16162913  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #13
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 221 - 321
Target Start/End: Original strand, 27754412 - 27754512
Alignment:
221 gttttcataagctatcctggagagcttatgaaaatgagtttaaaacagggtatgaacatgtcatgaactgttttcataagttctctcaaacagtctaaca 320  Q
    |||||||||||||||  |||||||||||||||||| || | ||  ||   ||| | |||||||| |||||||||||||||||||| |||| ||||| |||    
27754412 gttttcataagctattttggagagcttatgaaaataagctgaacgcaacttataatcatgtcataaactgttttcataagttctcccaaatagtctcaca 27754511  T
321 a 321  Q
    |    
27754512 a 27754512  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #14
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 220 - 310
Target Start/End: Original strand, 1930042 - 1930133
Alignment:
220 tgttttcataagctatcctggagagcttatgaaaatgagtttaaaacagggtatgaac-atgtcatgaactgttttcataagttctctcaaa 310  Q
    ||||||||||||||||| ||| || ||| ||||||| || | |||||||  ||||||| ||||||| ||||||||||| |||||||| ||||    
1930042 tgttttcataagctatcttggtgaccttgtgaaaataagctgaaaacagcttatgaacaatgtcataaactgttttcacaagttctcccaaa 1930133  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #15
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 95 - 180
Target Start/End: Original strand, 4389826 - 4389908
Alignment:
95 tttggataaataacttaatttgcaacttacatcataagaagtgcttatcatataagcgcttatggataagctatttttataacaca 180  Q
    ||||||||||||||||| |||||| |||| | ||   |||||||||||||||| ||| | |||| ||||||||||| |||||||||    
4389826 tttggataaataacttattttgcagcttatagca---gaagtgcttatcatatgagcacatatgaataagctatttctataacaca 4389908  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #16
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 214 - 305
Target Start/End: Original strand, 5088853 - 5088944
Alignment:
214 ataacttgttttcataagctatcctggagagcttatgaaaatgagtttaaaacagggtatgaacatgtcatgaactgttttcataagttctc 305  Q
    |||| ||||||||| |||| ||||||||||||||||  |||| |||| |||||||  |||| |||||| || |||||||| |||||| ||||    
5088853 ataagttgttttcacaagcgatcctggagagcttattgaaataagttgaaaacagcttatggacatgttataaactgtttccataagctctc 5088944  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #17
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 240 - 364
Target Start/End: Original strand, 9700028 - 9700154
Alignment:
240 gagagcttatgaaaatgagtttaaaacagggtatgaacatgtcatgaactgttttcataagttctctcaaacagtctaacaagtgcttatacaag--aat 337  Q
    |||||||||||||||| || | |||||||  |||| ||||||||| || || ||||| ||| ||||||||| ||||| ||||||| |||| | ||   ||    
9700028 gagagcttatgaaaataaggtgaaaacagcttatggacatgtcataaattgatttcacaagctctctcaaatagtctcacaagtgtttatgctagtagat 9700127  T
338 agcctcaaataagtcaatccaaacagg 364  Q
    |  ||||||||||| ||||||||||||    
9700128 aagctcaaataagttaatccaaacagg 9700154  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #18
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 222 - 329
Target Start/End: Complemental strand, 30191202 - 30191095
Alignment:
222 ttttcataagctatcctggagagcttatgaaaatgagtttaaaacagggtatgaacatgtcatgaactgttttcataagttctctcaaacagtctaacaa 321  Q
    |||| ||||||||||||| |  | ||||| |||| || | |||||| | | |||||||||||| |  ||||| |||||| |||| |||||||||||||||    
30191202 ttttgataagctatcctgaaatgtttatggaaataagctgaaaacaagttttgaacatgtcataagttgtttccataagctctcccaaacagtctaacaa 30191103  T
322 gtgcttat 329  Q
    ||||||||    
30191102 gtgcttat 30191095  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #19
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 220 - 299
Target Start/End: Complemental strand, 35220786 - 35220707
Alignment:
220 tgttttcataagctatcctggagagcttatgaaaatgagtttaaaacagggtatgaacatgtcatgaactgttttcataa 299  Q
    |||||||||||||||| ||||||||||||| ||||| || | |||| ||  ||||  |||||||| ||||||||||||||    
35220786 tgttttcataagctattctggagagcttataaaaataagctaaaaatagcttatgggcatgtcataaactgttttcataa 35220707  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #20
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 219 - 305
Target Start/End: Complemental strand, 2458630 - 2458544
Alignment:
219 ttgttttcataagctatcctggagagcttatgaaaatgagtttaaaacagggtatgaacatgtcatgaactgttttcataagttctc 305  Q
    |||||| ||||||||||||| ||||||||||| |||| |  | |||||||  |||||||||| ||| | |||| |||||||||||||    
2458630 ttgtttacataagctatcctagagagcttatggaaataaactgaaaacagcttatgaacatgccataagctgtcttcataagttctc 2458544  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #21
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 238 - 315
Target Start/End: Original strand, 10120781 - 10120859
Alignment:
238 tggagagcttatgaaaatgagtttaaaacagggtatga-acatgtcatgaactgttttcataagttctctcaaacagtc 315  Q
    |||||| ||||||||||| || | |||||||  ||||| | ||||||| | ||||||||||||||||||||||||||||    
10120781 tggagaacttatgaaaataagctgaaaacagcatatgataaatgtcataagctgttttcataagttctctcaaacagtc 10120859  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #22
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 134 - 196
Target Start/End: Original strand, 14482121 - 14482183
Alignment:
134 agtgcttatcatataagcgcttatggataagctatttttataacacaacataaaattaagtca 196  Q
    ||||||||||||||||| ||||||| |||| |||||| ||||||| || ||||||| ||||||    
14482121 agtgcttatcatataagtgcttatgtataaactatttctataacaaaagataaaataaagtca 14482183  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #23
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 220 - 254
Target Start/End: Original strand, 25097393 - 25097427
Alignment:
220 tgttttcataagctatcctggagagcttatgaaaa 254  Q
    |||||||||||||||||||||||||||||||||||    
25097393 tgttttcataagctatcctggagagcttatgaaaa 25097427  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #24
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 262 - 316
Target Start/End: Complemental strand, 41442474 - 41442420
Alignment:
262 aaaacagggtatgaacatgtcatgaactgttttcataagttctctcaaacagtct 316  Q
    |||||||  |||||||||||||| || |||||||||||||||| |||||||||||    
41442474 aaaacagcatatgaacatgtcataaattgttttcataagttctgtcaaacagtct 41442420  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #25
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 222 - 329
Target Start/End: Complemental strand, 42215143 - 42215044
Alignment:
222 ttttcataagctatcctggagagcttatgaaaatgagtttaaaacagggtatgaacatgtcatgaactgttttcataagttctctcaaacagtctaacaa 321  Q
    ||||||||||||||| ||||||||||||| |||| || | ||||||   |||||||||||        |||||||||||||||| |||||||| | ||||    
42215143 ttttcataagctatcttggagagcttatgtaaataagctgaaaacaacttatgaacatgt--------gttttcataagttctcccaaacagtgtcacaa 42215052  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #26
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 133 - 364
Target Start/End: Complemental strand, 28769491 - 28769256
Alignment:
133 aagtgcttatcatataagcgcttatggataagctatttttataacacaacataaaattaagtc--attgtttttgtataataaataacttgttttcataa 230  Q
    |||||||||||||||||  ||||||| ||||||||||  ||||||| |  |||||||||||||  | | ||||  |||||   ||||  |||||||||||    
28769491 aagtgcttatcatataaatgcttatgtataagctattcctataacaaactataaaattaagtcaaactattttcttataagctataagctgttttcataa 28769392  T
231 gctatcctggagagcttatgaaaatgagtttaaaacagggtatgaacatgtcatgaactgttttcataagttctctcaaacagtctaacaagtgcttata 330  Q
    |||||  ||||||| ||||| |||| || | ||||||   |||| |||| ||||   || ||| || ||| ||||||||| | ||| ||||||||||||     
28769391 gctattttggagagtttatggaaataagctgaaaacaacttatggacatatcatatgctatttacacaagctctctcaaataatctcacaagtgcttatg 28769292  T
331 caag--aatagcctcaaataagtcaatccaaacagg 364  Q
    | ||   ||||||| ||||||| ||||| |||||||    
28769291 ccagtagatagcctaaaataagacaatcaaaacagg 28769256  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #27
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 214 - 255
Target Start/End: Original strand, 43709274 - 43709315
Alignment:
214 ataacttgttttcataagctatcctggagagcttatgaaaat 255  Q
    |||| |||||||||| ||||||||||||||||||||||||||    
43709274 ataagttgttttcatgagctatcctggagagcttatgaaaat 43709315  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #28
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 220 - 329
Target Start/End: Complemental strand, 44236886 - 44236777
Alignment:
220 tgttttcataagctatcctggagagcttatgaaaatgagtttaaaacagggtatgaacatgtcatgaactgttttcataagttctctcaaacagtctaac 319  Q
    ||||||||||||||||  |||||||||||||||||| || | |||| |   || || |||||| ||| || ||||||||  ||||| | |||||||| ||    
44236886 tgttttcataagctatattggagagcttatgaaaataagctgaaaataacttaagagcatgtcgtgagctattttcatagattctcccgaacagtctcac 44236787  T
320 aagtgcttat 329  Q
    ||||||||||    
44236786 aagtgcttat 44236777  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #29
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 289 - 329
Target Start/End: Complemental strand, 2488002 - 2487962
Alignment:
289 tgttttcataagttctctcaaacagtctaacaagtgcttat 329  Q
    ||||||||||||||||| |||||||||| ||||||||||||    
2488002 tgttttcataagttctcccaaacagtctcacaagtgcttat 2487962  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #30
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 220 - 260
Target Start/End: Complemental strand, 9836917 - 9836877
Alignment:
220 tgttttcataagctatcctggagagcttatgaaaatgagtt 260  Q
    ||||||||||||||||| ||||||||||||| |||||||||    
9836917 tgttttcataagctatcttggagagcttatggaaatgagtt 9836877  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #31
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 154 - 305
Target Start/End: Original strand, 13459585 - 13459737
Alignment:
154 ttatggataagctatttttataacacaacataaaattaagtcattgtttt-tgtataataaataacttgttttcataagctatcctggagagcttatgaa 252  Q
    ||||| ||||||||||| ||| | | || ||||||| ||||||   |||| |||||||   |||| ||||||||||||   |||||  ||||||||||||    
13459585 ttatgtataagctatttctatgataaaagataaaatgaagtcaactttttgtgtataagctataagttgttttcataaatcatcctacagagcttatgaa 13459684  T
253 aatgagtttaaaacagggtatgaacatgtcatgaactgttttcataagttctc 305  Q
    |||  | | |||||||  |||||| ||||||| | ||||||||||||||||||    
13459685 aataggctgaaaacagtttatgaaaatgtcataagctgttttcataagttctc 13459737  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #32
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 214 - 329
Target Start/End: Original strand, 24558854 - 24558967
Alignment:
214 ataacttgttttcataagctatcctggagagcttatgaaaatgagtttaaaacagggtatgaacatgtcatgaactgttttcataagttctctcaaacag 313  Q
    |||| |||||||||||||||||| ||||||  | ||| |||| |||| || | ||  ||||||| |||||| |||  |||||||| |||||| |||||||    
24558854 ataagttgttttcataagctatcttggagacttaatgtaaataagttgaacatagcttatgaacgtgtcataaac--ttttcataggttctcccaaacag 24558951  T
314 tctaacaagtgcttat 329  Q
    ||| ||||||| ||||    
24558952 tctcacaagtgtttat 24558967  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #33
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 177 - 329
Target Start/End: Original strand, 34849065 - 34849220
Alignment:
177 cacaacataaaattaagtca--ttgtttttgtataataaataacttgttttcataagctatcctggagagcttatgaaaatgagtttaaaacagggtatg 274  Q
    ||||| ||||||| ||||||  || ||||||||||| | ||||  |||| ||||||||| || || ||| |||||| |||| || | ||||| |  ||||    
34849065 cacaagataaaataaagtcacattatttttgtataagatataagctgttatcataagctttcttgtagaacttatggaaatcagctgaaaacggcttatg 34849164  T
275 aacatgtcatgaa-ctgttttcataagttctctcaaacagtctaacaagtgcttat 329  Q
    |||||||||| ||  ||||||||| ||||||| |||||||||| | |||| |||||    
34849165 aacatgtcataaagttgttttcattagttctcccaaacagtctcaaaagtacttat 34849220  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #34
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 238 - 321
Target Start/End: Complemental strand, 35644033 - 35643949
Alignment:
238 tggagagcttatgaaaatgagtttaaaacagggtatgaacat-gtcatgaactgttttcataagttctctcaaacagtctaacaa 321  Q
    |||||||||||||||||| |||| |||| ||  |||||| || ||||| |||| |||||||||||| || |||||||||| ||||    
35644033 tggagagcttatgaaaataagttgaaaaaagcttatgaaaattgtcataaactattttcataagttatcccaaacagtctcacaa 35643949  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #35
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 220 - 312
Target Start/End: Original strand, 40071756 - 40071848
Alignment:
220 tgttttcataagctatcctggagagcttatgaaaatgagtttaaaacagggtatgaacatgtcatgaactgttttcataagttctctcaaaca 312  Q
    |||||||| |||||||||| || ||||||||||||| |||| ||| | |  |||||||||||||| |  ||||| |||||| |||| ||||||    
40071756 tgttttcagaagctatcctagaaagcttatgaaaattagttgaaagctgattatgaacatgtcataagttgtttccataagctctcccaaaca 40071848  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #36
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 133 - 176
Target Start/End: Original strand, 6918949 - 6918992
Alignment:
133 aagtgcttatcatataagcgcttatggataagctatttttataa 176  Q
    ||||| |||||||||||| ||||||| |||||||||||||||||    
6918949 aagtgtttatcatataagtgcttatgtataagctatttttataa 6918992  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #37
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 220 - 255
Target Start/End: Original strand, 27028838 - 27028873
Alignment:
220 tgttttcataagctatcctggagagcttatgaaaat 255  Q
    ||||||||||||||||| ||||||||||||||||||    
27028838 tgttttcataagctatcttggagagcttatgaaaat 27028873  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #38
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 146 - 267
Target Start/End: Complemental strand, 34522195 - 34522070
Alignment:
146 ataagcgcttatggataagctatttttataacacaacataaaattaagtca---ttgttttt-gtataataaataacttgttttcataagctatcctgga 241  Q
    ||||||||||||| ||||||||||| ||| |||||| ||||||| ||||||   |  ||||| |||||||  | ||  | |||||| ||||||||||  |    
34522195 ataagcgcttatgaataagctatttctatgacacaagataaaataaagtcaaactactttttagtataatctaaaaggtattttcaaaagctatcctaaa 34522096  T
242 gagcttatgaaaatgagtttaaaaca 267  Q
    ||||||||||||||||| | ||||||    
34522095 gagcttatgaaaatgaggtaaaaaca 34522070  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #39
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 289 - 364
Target Start/End: Complemental strand, 6526246 - 6526169
Alignment:
289 tgttttcataagttctctcaaacagtctaacaagtgcttatacaag--aatagcctcaaataagtcaatccaaacagg 364  Q
    ||||||| |||||||||||||||| ||| ||||| |||||| | ||   |||| ||| ||||||||||||||||||||    
6526246 tgttttcctaagttctctcaaacaatctcacaagggcttatgccagtagataggctcgaataagtcaatccaaacagg 6526169  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #40
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 154 - 329
Target Start/End: Original strand, 7646145 - 7646322
Alignment:
154 ttatggataagctatttttataacacaacataaaattaagtca--ttgtttttgtataataaataacttgttttcataagctatcctggagagcttatga 251  Q
    ||||| ||||||||||| ||||| | ||  |||||| |||| |  |||||||||||||||  ||||  ||| ||||||||||  || ||||||||||||     
7646145 ttatgtataagctatttctataagaaaaggtaaaataaagttaaattgtttttgtataatctataaactgtcttcataagctgaccaggagagcttatgg 7646244  T
252 aaatgagtttaaaacagggtatgaacatgtcatgaactgttttcataagttctctcaaacagtctaacaagtgcttat 329  Q
    |||| || | |||| ||   || |||||||||| | | |||||||||| ||||| |||||| | | || |||||||||    
7646245 aaataagctgaaaatagctgatcaacatgtcataagcagttttcataaattctcccaaacattgtcactagtgcttat 7646322  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #41
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 219 - 329
Target Start/End: Original strand, 10923602 - 10923712
Alignment:
219 ttgttttcataagctatcctggagagcttatgaaaatgagtttaaaacagggtatgaacatgtcatgaactgttttcataagttctctcaaacagtctaa 318  Q
    |||||||||| |||||| ||||||||||||||||||| || | |||||||  |||  | ||||| |  | |||||||||||  |||||||||  |||| |    
10923602 ttgttttcattagctattctggagagcttatgaaaataagataaaaacagtttattgatatgtcttacattgttttcataaactctctcaaattgtctta 10923701  T
319 caagtgcttat 329  Q
    |||||| ||||    
10923702 caagtgtttat 10923712  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #42
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 286 - 332
Target Start/End: Original strand, 10939448 - 10939494
Alignment:
286 aactgttttcataagttctctcaaacagtctaacaagtgcttataca 332  Q
    ||||||||||||||||||||  ||||||||| | |||||||||||||    
10939448 aactgttttcataagttctcctaaacagtctcagaagtgcttataca 10939494  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #43
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 155 - 250
Target Start/End: Complemental strand, 13561442 - 13561345
Alignment:
155 tatggataagctatttttataacacaacataaaattaagtca--ttgtttttgtataataaataacttgttttcataagctatcctggagagcttatg 250  Q
    |||| ||||||||||| ||||||| || || |||| ||||||  |||||||  |||||   |||||||||||||| |||||||| | |||||||||||    
13561442 tatgaataagctatttctataacagaaaattaaataaagtcaaattgttttcatataaattataacttgttttcacaagctatcattgagagcttatg 13561345  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #44
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 220 - 329
Target Start/End: Original strand, 26410286 - 26410396
Alignment:
220 tgttttcataagctatcctggagagcttatgaaaatga-gtttaaaacagggtatgaacatgtcatgaactgttttcataagttctctcaaacagtctaa 318  Q
    |||||||| || || |||||||||||||||| |||| | | | |||||||  | || ||||||||||| |||||| |||||| |||| ||| |||||| |    
26410286 tgttttcaaaaactgtcctggagagcttatggaaataaagctaaaaacagcttctggacatgtcatgagctgtttccataagctctcccaagcagtctca 26410385  T
319 caagtgcttat 329  Q
     ||||||||||    
26410386 gaagtgcttat 26410396  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #45
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 220 - 249
Target Start/End: Complemental strand, 6509366 - 6509337
Alignment:
220 tgttttcataagctatcctggagagcttat 249  Q
    ||||||||||||||||||||||||||||||    
6509366 tgttttcataagctatcctggagagcttat 6509337  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #46
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 222 - 255
Target Start/End: Complemental strand, 10075612 - 10075579
Alignment:
222 ttttcataagctatcctggagagcttatgaaaat 255  Q
    ||||||||||||||||| ||||||||||||||||    
10075612 ttttcataagctatcctagagagcttatgaaaat 10075579  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #47
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 223 - 284
Target Start/End: Original strand, 11795102 - 11795163
Alignment:
223 tttcataagctatcctggagagcttatgaaaatgagtttaaaacagggtatgaacatgtcat 284  Q
    |||||||||||||  ||||||||||||| |||| || | |||||||| |||| |||||||||    
11795102 tttcataagctattatggagagcttatggaaataagctgaaaacaggttatggacatgtcat 11795163  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #48
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 220 - 330
Target Start/End: Original strand, 12361199 - 12361311
Alignment:
220 tgttttcataagctatcctggagagcttatgaaaatgagtttaaaacagggtatgaacatgtcatgaactgttttcataag--ttctctcaaacagtcta 317  Q
    |||||||||||| ||| | |||||||| ||| |||| |||| |||||||  |||| ||||||||| | || |||  |||||   ||||||||| ||||||    
12361199 tgttttcataagttattcaggagagctaatggaaataagttgaaaacagcttatggacatgtcataagctatttctataagatctctctcaaagagtcta 12361298  T
318 acaagtgcttata 330  Q
    |||||| ||||||    
12361299 acaagtacttata 12361311  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #49
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 271 - 316
Target Start/End: Original strand, 25097433 - 25097478
Alignment:
271 tatgaacatgtcatgaactgttttcataagttctctcaaacagtct 316  Q
    |||||||||||||||| ||||| ||||| |||||| ||||||||||    
25097433 tatgaacatgtcatgagctgttctcatatgttctcccaaacagtct 25097478  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #50
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 214 - 255
Target Start/End: Original strand, 34551121 - 34551162
Alignment:
214 ataacttgttttcataagctatcctggagagcttatgaaaat 255  Q
    |||| |||||||| |||| |||||||||||||||||||||||    
34551121 ataagttgttttcttaagttatcctggagagcttatgaaaat 34551162  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #51
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 276 - 329
Target Start/End: Original strand, 34770931 - 34770984
Alignment:
276 acatgtcatgaactgttttcataagttctctcaaacagtctaacaagtgcttat 329  Q
    ||||||||| | ||||||||||| | ||||||||||||| | ||||||||||||    
34770931 acatgtcataagctgttttcataggatctctcaaacagtttcacaagtgcttat 34770984  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #52
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 169 - 239
Target Start/End: Original strand, 38537545 - 38537617
Alignment:
169 ttttataacacaacataaaattaagtca--ttgtttttgtataataaataacttgttttcataagctatcctg 239  Q
    ||||||||||||| ||||||| ||||||  |||||||||||||||  ||||  || |||||||| ||||||||    
38537545 ttttataacacaagataaaatgaagtcaatttgtttttgtataatctataagctgctttcataaactatcctg 38537617  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #53
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 291 - 332
Target Start/End: Complemental strand, 41398100 - 41398059
Alignment:
291 ttttcataagttctctcaaacagtctaacaagtgcttataca 332  Q
    ||||||||||||||||||||||||||  || |||||||||||    
41398100 ttttcataagttctctcaaacagtctcgcaggtgcttataca 41398059  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #54
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 289 - 329
Target Start/End: Original strand, 778465 - 778505
Alignment:
289 tgttttcataagttctctcaaacagtctaacaagtgcttat 329  Q
    ||||||||||||||||  |||||||||| ||||||||||||    
778465 tgttttcataagttcttgcaaacagtctcacaagtgcttat 778505  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #55
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 281 - 329
Target Start/End: Original strand, 24326099 - 24326147
Alignment:
281 tcatgaactgttttcataagttctctcaaacagtctaacaagtgcttat 329  Q
    |||| |||||||| |||||| |||| |||||||||| ||||||||||||    
24326099 tcataaactgtttccataagctctcccaaacagtctcacaagtgcttat 24326147  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #56
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 146 - 194
Target Start/End: Original strand, 26215427 - 26215475
Alignment:
146 ataagcgcttatggataagctatttttataacacaacataaaattaagt 194  Q
    ||||||||||||| ||||||||||| ||||||| || ||||||| ||||    
26215427 ataagcgcttatgtataagctatttctataacaaaagataaaataaagt 26215475  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #57
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 273 - 313
Target Start/End: Complemental strand, 30947473 - 30947433
Alignment:
273 tgaacatgtcatgaactgttttcataagttctctcaaacag 313  Q
    |||||||||||| ||||||||||||||| || |||||||||    
30947473 tgaacatgtcataaactgttttcataagctccctcaaacag 30947433  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #58
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 220 - 268
Target Start/End: Original strand, 31862500 - 31862548
Alignment:
220 tgttttcataagctatcctggagagcttatgaaaatgagtttaaaacag 268  Q
    |||||||||||| |||||| |||||||||||||||| || | |||||||    
31862500 tgttttcataagttatcctagagagcttatgaaaataagctgaaaacag 31862548  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #59
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 211 - 255
Target Start/End: Complemental strand, 39881824 - 39881780
Alignment:
211 taaataacttgttttcataagctatcctggagagcttatgaaaat 255  Q
    ||||||| ||||||| |||||||||| ||||||||||||| ||||    
39881824 taaataaattgtttttataagctatcatggagagcttatggaaat 39881780  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #60
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 133 - 172
Target Start/End: Complemental strand, 40859871 - 40859831
Alignment:
133 aagtgcttatcat-ataagcgcttatggataagctattttt 172  Q
    ||||||||||||| ||||||||||||| |||||||||||||    
40859871 aagtgcttatcatgataagcgcttatgtataagctattttt 40859831  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #61
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 220 - 328
Target Start/End: Original strand, 43504758 - 43504866
Alignment:
220 tgttttcataagctatcctggagagcttatgaaaatgagtttaaaacagggtatgaacatgtcatgaactgttttcataagttctctcaaacagtctaac 319  Q
    |||||| |||||||||| |||||| |||||| |||| || | |||||||  ||| |||| ||| | |  ||||||||| |||||||  ||||||||  ||    
43504758 tgtttttataagctatcttggagaacttatggaaataagctgaaaacagcttataaacaagtcgtaagttgttttcatcagttctccgaaacagtcacac 43504857  T
320 aagtgctta 328  Q
    |||||||||    
43504858 aagtgctta 43504866  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 54; Significance: 8e-22; HSPs: 66)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 54; E-Value: 8e-22
Query Start/End: Original strand, 224 - 329
Target Start/End: Complemental strand, 31517799 - 31517694
Alignment:
224 ttcataagctatcctggagagcttatgaaaatgagtttaaaacagggtatgaacatgtcatgaactgttttcataagttctctcaaacagtctaacaagt 323  Q
    ||||||| || || |||||||||||||||||| || | |||||||  ||||||||||||||||  |||||| |||||||||| |||||||||| ||||||    
31517799 ttcataatctgtcttggagagcttatgaaaataagctgaaaacagcttatgaacatgtcatgagttgttttgataagttctcccaaacagtctcacaagt 31517700  T
324 gcttat 329  Q
    ||||||    
31517699 gcttat 31517694  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 220 - 314
Target Start/End: Original strand, 37811859 - 37811953
Alignment:
220 tgttttcataagctatcctggagagcttatgaaaatgagtttaaaacagggtatgaacatgtcatgaactgttttcataagttctctcaaacagt 314  Q
    ||||||||||||| ||| ||||||||| ||| |||| |||| |||||||  |||||||||||||| | |||||||||||||||||||||| ||||    
37811859 tgttttcataagccatcatggagagctaatggaaataagttgaaaacagtttatgaacatgtcataagctgttttcataagttctctcaaccagt 37811953  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 154 - 292
Target Start/End: Complemental strand, 36151636 - 36151496
Alignment:
154 ttatggataagctatttttataacacaacataaaattaagtca--ttgtttttgtataataaataacttgttttcataagctatcctggagagcttatga 251  Q
    ||||| |||||||||||  |||||| || ||||||| ||||||  ||||||| ||||||   |||| |||||||| ||| | ||||| | ||||||||||    
36151636 ttatgtataagctatttcaataacaaaagataaaataaagtcaaattgttttcgtataagttataaattgttttcgtaaacaatcctagtgagcttatga 36151537  T
252 aaatgagtttaaaacagggtatgaacatgtcatgaactgtt 292  Q
    |||| |||| |||||||| |||| ||||||||| |||||||    
36151536 aaataagttgaaaacaggttatggacatgtcataaactgtt 36151496  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 142 - 364
Target Start/End: Original strand, 17269177 - 17269403
Alignment:
142 tcatataagcgcttatggataagctatttttataacacaacataaaattaagtca--ttgtttttgtataataaataacttgttttcataagctatcctg 239  Q
    ||||||||| ||||||| ||||| ||||| || |||| ||   ||||| ||||||  |||||||  |||||  ||||| |||||||||||||||||||||    
17269177 tcatataagtgcttatgtataagttatttctagaacaaaagtgaaaataaagtcaaattgttttcatataagcaataagttgttttcataagctatcctg 17269276  T
240 gagagcttatgaaaatgagtttaaaacagggtatgaacatgtcatgaactgttttcataagttctctcaaacagtctaacaagtgcttatacaaga--at 337  Q
    ||||||||| |  ||| |||| ||||||    ||||||||||||| |  | ||||||||||  ||  |||||| ||| ||||||| ||| | ||||  ||    
17269277 gagagcttacggtaataagttaaaaacaactcatgaacatgtcataaggtattttcataagcactaccaaacaatctcacaagtgtttaaataagaagat 17269376  T
338 agcctcaaataagtcaatccaaacagg 364  Q
    |   |||||||||||||||||||||||    
17269377 aagttcaaataagtcaatccaaacagg 17269403  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 219 - 303
Target Start/End: Original strand, 35925696 - 35925780
Alignment:
219 ttgttttcataagctatcctggagagcttatgaaaatgagtttaaaacagggtatgaacatgtcatgaactgttttcataagttc 303  Q
    |||||| ||||||||||| ||||||| ||||| |||| |||| |||||||  |||||||||||||| | ||||||||||||||||    
35925696 ttgtttccataagctatcatggagagtttatggaaataagttgaaaacagcttatgaacatgtcataagctgttttcataagttc 35925780  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 153 - 329
Target Start/End: Complemental strand, 10199540 - 10199362
Alignment:
153 cttatggataagctatttttataacacaacataaaattaagtcat--tgtttttgtataataaataacttgttttcataagctatcctggagagcttatg 250  Q
    ||||| |||||| ||||| |||||| ||| ||||||| ||||||   | |||| |||||||  ||||  | ||||||||||||||  | |||||||||||    
10199540 cttatagataagttatttctataacccaagataaaataaagtcaaactattttcgtataatcgataagcttttttcataagctattttagagagcttatg 10199441  T
251 aaaatgagtttaaaacagggtatgaacatgtcatgaactgttttcataagttctctcaaacagtctaacaagtgcttat 329  Q
    ||||| || | ||||||   |||||||||||||| | || ||||||| ||||||| |||| ||| | ||||||||||||    
10199440 aaaataagctgaaaacaacttatgaacatgtcataagctattttcatgagttctcccaaatagtgtcacaagtgcttat 10199362  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 222 - 328
Target Start/End: Original strand, 4445717 - 4445823
Alignment:
222 ttttcataagctatcctggagagcttatgaaaatgagtttaaaacagggtatgaacatgtcatgaactgttttcataagttctctcaaacagtctaacaa 321  Q
    ||||||||||||  | |||||||||| ||||||| |||| |||||||  | ||||||||| || | ||| |||||||| ||||| |||||||||| ||||    
4445717 ttttcataagctgacttggagagcttgtgaaaataagttgaaaacagcttctgaacatgttataagctgctttcataaattctcccaaacagtctcacaa 4445816  T
322 gtgctta 328  Q
    |||||||    
4445817 gtgctta 4445823  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 223 - 329
Target Start/End: Complemental strand, 37593744 - 37593638
Alignment:
223 tttcataagctatcctggagagcttatgaaaatgagtttaaaacagggtatgaacatgtcatgaactgttttcataagttctctcaaacagtctaacaag 322  Q
    |||||||||||||  || ||||||||||||||| || | |||||||  |||||||||||||| |  ||| ||||| |||| || ||||||||||||||||    
37593744 tttcataagctattttgaagagcttatgaaaataagctgaaaacagcttatgaacatgtcataagttgtgttcattagttttcccaaacagtctaacaag 37593645  T
323 tgcttat 329  Q
    || ||||    
37593644 tgtttat 37593638  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #9
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 221 - 329
Target Start/End: Complemental strand, 49692112 - 49692006
Alignment:
221 gttttcataagctatcctggagagcttatgaaaatgagtttaaaacagggtatgaacatgtcatgaactgttttcataagttctctcaaacagtctaaca 320  Q
    ||||||||||| ||||||||||| || |||||||| || | ||||||   |||| ||||||||| | || |||||||||||||||||||||||||| |||    
49692112 gttttcataagttatcctggagaact-atgaaaat-agctgaaaacaaactatggacatgtcataagctattttcataagttctctcaaacagtctcaca 49692015  T
321 agtgcttat 329  Q
    ||| |||||    
49692014 agttcttat 49692006  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #10
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 137 - 196
Target Start/End: Original strand, 870967 - 871026
Alignment:
137 gcttatcatataagcgcttatggataagctatttttataacacaacataaaattaagtca 196  Q
    |||||||||||||| ||||||| |||| |||||||||||||| || ||||||||||||||    
870967 gcttatcatataagtgcttatgtataaactatttttataacaaaagataaaattaagtca 871026  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #11
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 153 - 265
Target Start/End: Original strand, 35017512 - 35017628
Alignment:
153 cttatggataagctatttttataacacaacataaaattaagtcat----tgtttttgtataataaataacttgttttcataagctatcctggagagctta 248  Q
    |||||| ||||||||||||||||| |||| ||||||| ||||||     |||||| |||||||  |||   |||||||||||||| ||||||||||||||    
35017512 cttatgaataagctatttttataatacaagataaaataaagtcaaacactgttttcgtataatctatatgctgttttcataagctgtcctggagagctta 35017611  T
249 tgaaaatgagtttaaaa 265  Q
    || |||| |||| ||||    
35017612 tggaaataagttgaaaa 35017628  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #12
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 214 - 300
Target Start/End: Original strand, 25479582 - 25479668
Alignment:
214 ataacttgttttcataagctatcctggagagcttatgaaaatgagtttaaaacagggtatgaacatgtcatgaactgttttcataag 300  Q
    |||| |||||||||||||||||||| |||||||||||||||| || | ||||||    ||||||||||||| | || ||||||||||    
25479582 ataagttgttttcataagctatcctagagagcttatgaaaataagctgaaaacaactaatgaacatgtcataatctattttcataag 25479668  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #13
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 138 - 268
Target Start/End: Original strand, 4200152 - 4200284
Alignment:
138 cttatcatataagcgcttatggataagctatttttataacacaacataaaattaagtca--ttgtttttgtataataaataacttgttttcataagctat 235  Q
    |||||||| |||| | ||||  ||||| ||||||||||||| || ||||||| ||||||  |||||||  |||||   |||  |||||||| |||| |||    
4200152 cttatcatctaagtgtttatatataagttatttttataacaaaagataaaataaagtcaagttgttttcatataagctatatattgttttcgtaagatat 4200251  T
236 cctggagagcttatgaaaatgagtttaaaacag 268  Q
    ||||||| |||||||||||| || |||||||||    
4200252 cctggagggcttatgaaaataagcttaaaacag 4200284  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #14
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 200 - 329
Target Start/End: Complemental strand, 7137081 - 7136952
Alignment:
200 tttttgtataataaataacttgttttcataagctatcctggagagcttatgaaaatgagtttaaaacagggtatgaacatgtcatgaactgttttcataa 299  Q
    ||||||||||||  ||||  ||||||||||||||||| |||||| ||||||||||| || | |||| |   |||||| ||||||| | |  |||||||||    
7137081 tttttgtataatctataagctgttttcataagctatcttggagaacttatgaaaataagctgaaaataacttatgaatatgtcataagcgattttcataa 7136982  T
300 gttctctcaaacagtctaacaagtgcttat 329  Q
    ||||| ||||||  | ||||||||| ||||    
7136981 gttctttcaaactctttaacaagtgtttat 7136952  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #15
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 196 - 284
Target Start/End: Original strand, 7472294 - 7472383
Alignment:
196 attgtttttgtataataaataacttgttttcataagctatcctggagagcttatgaaaatgagtttaaaacag-ggtatgaacatgtcat 284  Q
    ||||||||||||||||  ||||  ||||| ||||||||||| |||||||||||||||||| || | |||||||   ||||||||||||||    
7472294 attgtttttgtataatctataagctgtttccataagctatcttggagagcttatgaaaataagctgaaaacagttttatgaacatgtcat 7472383  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #16
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 219 - 308
Target Start/End: Complemental strand, 24460471 - 24460382
Alignment:
219 ttgttttcataagctatcctggagagcttatgaaaatgagtttaaaacagggtatgaacatgtcatgaactgttttcataagttctctca 308  Q
    |||||||||||||||||||| |||||||||  ||||| || |  ||||||  |||||||||||||| | || ||||||||| ||||||||    
24460471 ttgttttcataagctatccttgagagcttacaaaaataagctggaaacagcttatgaacatgtcataagctattttcataatttctctca 24460382  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #17
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 220 - 329
Target Start/End: Complemental strand, 33723445 - 33723336
Alignment:
220 tgttttcataagctatcctggagagcttatgaaaatgagtttaaaacagggtatgaacatgtcatgaactgttttcataagttctctcaaacagtctaac 319  Q
    ||||||||||||||| |||| | |||||||| |||| || | ||||||    ||||||||||||||| |||||| |||||||| || ||| |||||| ||    
33723445 tgttttcataagctaccctgtaaagcttatggaaataagctgaaaacatctcatgaacatgtcatgagctgtttccataagttttcccaagcagtctcac 33723346  T
320 aagtgcttat 329  Q
    ||||| ||||    
33723345 aagtgtttat 33723336  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #18
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 162 - 310
Target Start/End: Original strand, 3924571 - 3924721
Alignment:
162 aagctatttttataacacaacataaaattaagtcat--tgtttttgtataataaataacttgttttcataagctatcctggagagcttatgaaaatgagt 259  Q
    ||||||||| |||||||||| ||||||| ||| ||   |||||| |||||||  || | ||||||| ||||||||||||| |||| ||||| |||| ||     
3924571 aagctatttctataacacaagataaaatcaaggcaaactgttttcgtataatctattagttgtttttataagctatcctgaagagtttatggaaataagc 3924670  T
260 ttaaaacagggtatgaacatgtcatgaactgttttcataagttctctcaaa 310  Q
      ||||||   ||| ||||| |||| || |||||||||||||| |||||||    
3924671 cgaaaacaacttataaacatttcataaattgttttcataagttttctcaaa 3924721  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #19
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 222 - 329
Target Start/End: Original strand, 6279408 - 6279515
Alignment:
222 ttttcataagctatcctggagagcttatgaaaatgagtttaaaacagggtatgaacatgtcatgaactgttttcataagttctctcaaacagtctaacaa 321  Q
    ||||||||||||||||| ||||||||||| ||||  | | ||||||   |||| ||||||  | |||||||| |||||| |||||||||||| |  ||||    
6279408 ttttcataagctatcctagagagcttatggaaatacgctgaaaacaacttatggacatgtggttaactgtttccataagctctctcaaacagccacacaa 6279507  T
322 gtgcttat 329  Q
    ||||||||    
6279508 gtgcttat 6279515  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #20
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 220 - 362
Target Start/End: Complemental strand, 172639 - 172492
Alignment:
220 tgttttcataagctatcctggagagcttatgaaaatgagtttaaaacagggtatgaacatgtcatgaactgttttcataagttctctcaaacagtct--- 316  Q
    ||||||||| ||||||| ||||||  ||||  | || |||| |||||||  |||||||||| ||| |||||||||||||| ||||| || ||||| |       
172639 tgttttcattagctatcttggagaaattattgatataagttaaaaacagcctatgaacatgccataaactgttttcataaattctcccagacagtgtcac 172540  T
317 aacaagtgcttatacaag--aatagcctcaaataagtcaatccaaaca 362  Q
    ||||||||||||  ||||   |||  ||||||||||||||||||||||    
172539 aacaagtgcttaggcaagtagataaactcaaataagtcaatccaaaca 172492  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #21
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 214 - 268
Target Start/End: Complemental strand, 7218143 - 7218089
Alignment:
214 ataacttgttttcataagctatcctggagagcttatgaaaatgagtttaaaacag 268  Q
    |||| |||||||||||| |||||||||||| ||||||||||| |||| |||||||    
7218143 ataagttgttttcataacctatcctggagaacttatgaaaataagttgaaaacag 7218089  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #22
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 136 - 295
Target Start/End: Original strand, 10854654 - 10854815
Alignment:
136 tgcttatcatataagcgcttatggataagctatttttataacacaacataaaattaagtcat--tgtttttgtataataaataacttgttttcataagct 233  Q
    ||||||||||||||| | ||||| ||||| ||||| |  || |||| ||||||| ||||||   || |||||||||||  |||  |||||||||||  ||    
10854654 tgcttatcatataagtggttatgaataagttatttctgaaatacaagataaaataaagtcaaactgattttgtataatctatatgttgttttcatatact 10854753  T
234 atcctggagagcttatgaaaatgagtttaaaacagggtatgaacatgtcatgaactgttttc 295  Q
    |||||| | |||||| |||||| || | |||||||  | |||||||||||| | ||||||||    
10854754 atcctgaacagcttaagaaaataagctgaaaacagcttgtgaacatgtcataagctgttttc 10854815  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #23
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 214 - 304
Target Start/End: Complemental strand, 37842424 - 37842334
Alignment:
214 ataacttgttttcataagctatcctggagagcttatgaaaatgagtttaaaacagggtatgaacatgtcatgaactgttttcataagttct 304  Q
    |||| |||||||||||||||||| || ||| ||||| ||||| || | ||||| |  |||||||||||||| |  ||||||||||||||||    
37842424 ataagttgttttcataagctatcttgaagaacttataaaaataagctgaaaactgcttatgaacatgtcattagatgttttcataagttct 37842334  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #24
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 222 - 304
Target Start/End: Original strand, 43338125 - 43338207
Alignment:
222 ttttcataagctatcctggagagcttatgaaaatgagtttaaaacagggtatgaacatgtcatgaactgttttcataagttct 304  Q
    ||||||||||||| | ||||||||||||||||||  | | |||| ||  |||||||||||||| | |||||| ||||||||||    
43338125 ttttcataagctaacatggagagcttatgaaaataggctgaaaatagattatgaacatgtcataagctgtttccataagttct 43338207  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #25
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 224 - 329
Target Start/End: Complemental strand, 32515500 - 32515395
Alignment:
224 ttcataagctatcctggagagcttatgaaaatgagtttaaaacagggtatgaacatgtcatgaactgttttcataagttctctcaaacagtctaacaagt 323  Q
    ||||||||||||| ||||||||||||  | || |||| ||||||   |||  |||||||||   |||||| |||||| |||| |||||||||| ||||||    
32515500 ttcataagctatcatggagagcttatagatataagttgaaaacaacttattgacatgtcatacgctgtttccataagctctcccaaacagtctcacaagt 32515401  T
324 gcttat 329  Q
    ||||||    
32515400 gcttat 32515395  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #26
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 288 - 329
Target Start/End: Complemental strand, 43371886 - 43371845
Alignment:
288 ctgttttcataagttctctcaaacagtctaacaagtgcttat 329  Q
    ||||||||||||| ||||||||||||||| ||||||||||||    
43371886 ctgttttcataagctctctcaaacagtctcacaagtgcttat 43371845  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #27
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 222 - 294
Target Start/End: Original strand, 5047155 - 5047227
Alignment:
222 ttttcataagctatcctggagagcttatgaaaatgagtttaaaacagggtatgaacatgtcatgaactgtttt 294  Q
    ||||||||||||||| || |||||||||| |||| || | ||||||| ||||||| ||||| | |||||||||    
5047155 ttttcataagctatcatgaagagcttatggaaataagctgaaaacagcgtatgaatatgtccttaactgtttt 5047227  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #28
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 222 - 326
Target Start/End: Complemental strand, 7262579 - 7262475
Alignment:
222 ttttcataagctatcctggagagcttatgaaaatgagtttaaaacagggtatgaacatgtcatgaactgttttcataagttctctcaaacagtctaacaa 321  Q
    |||||||||||||||||| ||||||| || |||| || | |||||||  |||||||||||||  | ||||||| ||||| ||||  |||| |||| | ||    
7262579 ttttcataagctatcctgaagagcttgtggaaataaggtgaaaacagcttatgaacatgtcaaaagctgtttttataagctctccaaaaccgtctcaaaa 7262480  T
322 gtgct 326  Q
    |||||    
7262479 gtgct 7262475  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #29
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 219 - 299
Target Start/End: Original strand, 11137851 - 11137930
Alignment:
219 ttgttttcataagctatcctggagagcttatgaaaatgagtttaaaacagggtatgaacatgtcatgaactgttttcataa 299  Q
    ||||||| |||||||||| ||| |||||||| ||||  || | |||||||  |||||||||||||| ||||||||||||||    
11137851 ttgttttgataagctatcatggtgagcttataaaaaaaagct-aaaacagcatatgaacatgtcataaactgttttcataa 11137930  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #30
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 220 - 300
Target Start/End: Complemental strand, 11639479 - 11639399
Alignment:
220 tgttttcataagctatcctggagagcttatgaaaatgagtttaaaacagggtatgaacatgtcatgaactgttttcataag 300  Q
    ||||| |||||| ||| || |||||||||||||||| || | |||||||  |||| ||||||||| | |||||||||||||    
11639479 tgtttgcataagttattctagagagcttatgaaaataagctaaaaacagcttatggacatgtcataagctgttttcataag 11639399  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #31
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 214 - 254
Target Start/End: Complemental strand, 25005866 - 25005826
Alignment:
214 ataacttgttttcataagctatcctggagagcttatgaaaa 254  Q
    |||| ||||||||||||||||||||||||||||||| ||||    
25005866 ataagttgttttcataagctatcctggagagcttataaaaa 25005826  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #32
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 214 - 359
Target Start/End: Original strand, 29723490 - 29723637
Alignment:
214 ataacttgttttcataagctatcctggagagcttatgaaaatgagtttaaaacagggtatgaacatgtcatgaactgttttcataagttctctcaaacag 313  Q
    |||| ||| ||||| |||||| |||| || | ||||| |||| |||| |||||||  |||| ||||||||| | |||||| ||| |||||| |||||| |    
29723490 ataagttgctttcacaagctaccctgcagtggttatgtaaataagttgaaaacagtttatggacatgtcataagctgtttccattagttctttcaaactg 29723589  T
314 tctaacaagtgcttatacaag--aatagcctcaaataagtcaatccaa 359  Q
    | | |||||||||||| | ||  ||||  ||||||| |||||||||||    
29723590 tatcacaagtgcttatgctagtaaataagctcaaattagtcaatccaa 29723637  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #33
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 219 - 255
Target Start/End: Complemental strand, 38651495 - 38651459
Alignment:
219 ttgttttcataagctatcctggagagcttatgaaaat 255  Q
    ||||||||||||||||||||||||||||||| |||||    
38651495 ttgttttcataagctatcctggagagcttataaaaat 38651459  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #34
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 214 - 250
Target Start/End: Complemental strand, 47598490 - 47598454
Alignment:
214 ataacttgttttcataagctatcctggagagcttatg 250  Q
    |||| ||||||||||||||||||||||||||||||||    
47598490 ataagttgttttcataagctatcctggagagcttatg 47598454  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #35
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 220 - 315
Target Start/End: Original strand, 4576812 - 4576907
Alignment:
220 tgttttcataagctatcctggagagcttatgaaaatgagtttaaaacagggtatgaacatgtcatgaactgttttcataagttctctcaaacagtc 315  Q
    ||||||||||||||||  || | | ||||||||||| || | || |||   ||| |||||||||| |||| |||||||||||| ||||||||||||    
4576812 tgttttcataagctatattgaataacttatgaaaataagctgaacacaacttataaacatgtcataaactattttcataagttgtctcaaacagtc 4576907  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #36
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 222 - 301
Target Start/End: Complemental strand, 4699676 - 4699597
Alignment:
222 ttttcataagctatcctggagagcttatgaaaatgagtttaaaacagggtatgaacatgtcatgaactgttttcataagt 301  Q
    ||||||||| |||||| |||||||||||  |||| || | |||||||  |||||||||||||| |  |||||||||||||    
4699676 ttttcataaactatcccggagagcttatagaaataagctaaaaacagcttatgaacatgtcataagttgttttcataagt 4699597  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #37
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 238 - 329
Target Start/End: Original strand, 6292518 - 6292608
Alignment:
238 tggagagcttatgaaaatgagtttaaaacagggtatgaacatgtcatgaactgttttcataagttctctcaaacagtctaacaagtgcttat 329  Q
    |||||||||||||||||| || | |||||||  |||||||||||||| | ||||||| | || ||||| |||||| ||| | ||||||||||    
6292518 tggagagcttatgaaaataagctgaaaacagcttatgaacatgtcataagctgtttt-aaaaattctcccaaacaatctcaaaagtgcttat 6292608  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #38
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 220 - 311
Target Start/End: Original strand, 10744308 - 10744399
Alignment:
220 tgttttcataagctatcctggagagcttatgaaaatgagtttaaaacagggtatgaacatgtcatgaactgttttcataagttctctcaaac 311  Q
    |||||||||||||| || | |||| ||||| ||||| || | |||||||  |||||||||| ||| | ||||||||| |||||||| |||||    
10744308 tgttttcataagctgtcttagagaacttataaaaataagatgaaaacagcttatgaacatgccataagctgttttcacaagttctcccaaac 10744399  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #39
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 137 - 255
Target Start/End: Original strand, 19389824 - 19389943
Alignment:
137 gcttatcatataagcgcttatggataagctatttttataacacaacataaaattaagtcattgt-ttttgtataataaataacttgttttcataagctat 235  Q
    |||||||||||||   |||||  ||||| || |||||| |||||| ||||||| ||||||   | |||||||||| || | | | |||||||||||||||    
19389824 gcttatcatataataacttataaataagttacttttattacacaatataaaataaagtcaaactgttttgtataagaatttaatagttttcataagctat 19389923  T
236 cctggagagcttatgaaaat 255  Q
    | |||||||||| |||||||    
19389924 cttggagagcttgtgaaaat 19389943  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #40
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 227 - 314
Target Start/End: Complemental strand, 28689508 - 28689421
Alignment:
227 ataagctatcctggagagcttatgaaaatgagtttaaaacagggtatgaacatgtcatgaactgttttcataagttctctcaaacagt 314  Q
    |||||||||| |||| ||||||||||||| || | ||||||   |||| ||||||||| | |||||| | |||||||||| |||||||    
28689508 ataagctatcttggaaagcttatgaaaataagctgaaaacaacttatggacatgtcataagctgtttccgtaagttctctaaaacagt 28689421  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #41
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 196 - 299
Target Start/End: Original strand, 39596580 - 39596682
Alignment:
196 attgtttttgtataataaataacttgttttcataagctatcctggagagcttatgaaaatgagtttaaaacagggtatgaacatgtcatgaactgttttc 295  Q
    |||||||||||||||   ||||  || ||| |||||||||| |||||||||||| ||||| || || ||||||  ||  |||||||||| ||||||||||    
39596580 attgtttttgtataagctataagatggttttataagctatcttggagagcttataaaaataag-ttgaaacagcttaccaacatgtcataaactgttttc 39596678  T
296 ataa 299  Q
    ||||    
39596679 ataa 39596682  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #42
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 222 - 329
Target Start/End: Original strand, 44422708 - 44422815
Alignment:
222 ttttcataagctatcctggagagcttatgaaaatgagtttaaaacagggtatgaacatgtcatgaactgttttcataagttctctcaaacagtctaacaa 321  Q
    |||| ||||||||||||||||||||||||||||| || |  |  |||  |||| ||||||||| | || |||||||||| |||| || ||||||| | ||    
44422708 tttttataagctatcctggagagcttatgaaaataagctgtagtcagcttatggacatgtcataagctattttcataagctctcccagacagtctcaaaa 44422807  T
322 gtgcttat 329  Q
    ||| ||||    
44422808 gtgtttat 44422815  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #43
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 275 - 329
Target Start/End: Complemental strand, 5421952 - 5421898
Alignment:
275 aacatgtcatgaactgttttcataagttctctcaaacagtctaacaagtgcttat 329  Q
    |||||||| | ||||||||| |||||||||| ||||| |||| ||||||||||||    
5421952 aacatgtcttaaactgtttttataagttctcacaaacggtctcacaagtgcttat 5421898  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #44
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 232 - 298
Target Start/End: Original strand, 11695880 - 11695946
Alignment:
232 ctatcctggagagcttatgaaaatgagtttaaaacagggtatgaacatgtcatgaactgttttcata 298  Q
    |||| ||||| ||||||||||||| |||| |||||||  |||| ||||||||| |||||||| ||||    
11695880 ctattctggaaagcttatgaaaataagttgaaaacagcttatggacatgtcataaactgtttccata 11695946  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #45
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 227 - 329
Target Start/End: Complemental strand, 19092439 - 19092338
Alignment:
227 ataagctatcctggagagcttatgaaaatgagtttaaaacagggtatgaacatgtcatgaactgttttcataagttctctcaaacagtctaacaagtgct 326  Q
    ||||||||||||| ||||||||||||||| || | |||||||  |||| |||||||||  ||| |||||||||  | |||| ||||||||  |||| |||    
19092439 ataagctatcctgaagagcttatgaaaataaggtgaaaacagtttatg-acatgtcatagactattttcataaactgtctcgaacagtctcgcaagagct 19092341  T
327 tat 329  Q
    |||    
19092340 tat 19092338  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #46
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 271 - 329
Target Start/End: Original strand, 27807173 - 27807231
Alignment:
271 tatgaacatgtcatgaactgttttcataagttctctcaaacagtctaacaagtgcttat 329  Q
    |||||||| ||||| | ||| ||||||||| ||||||||||||||| |||| |||||||    
27807173 tatgaacacgtcatcagctgctttcataagctctctcaaacagtcttacaaatgcttat 27807231  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #47
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 271 - 321
Target Start/End: Original strand, 38001654 - 38001704
Alignment:
271 tatgaacatgtcatgaactgttttcataagttctctcaaacagtctaacaa 321  Q
    |||||||| ||||| | |||||||||||||||||| |||||||||| ||||    
38001654 tatgaacaggtcataagctgttttcataagttctcccaaacagtctcacaa 38001704  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #48
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 222 - 260
Target Start/End: Complemental strand, 45667823 - 45667785
Alignment:
222 ttttcataagctatcctggagagcttatgaaaatgagtt 260  Q
    ||||| |||||||||||||||||||||||||||| ||||    
45667823 ttttcttaagctatcctggagagcttatgaaaataagtt 45667785  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #49
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 249 - 314
Target Start/End: Original strand, 4481966 - 4482031
Alignment:
249 tgaaaatgagtttaaaacagggtatgaacatgtcatgaactgttttcataagttctctcaaacagt 314  Q
    ||||||| || | |||||||  ||||||||||| || |  ||||||||||||||||||||||||||    
4481966 tgaaaataagctaaaaacagcttatgaacatgtaataagttgttttcataagttctctcaaacagt 4482031  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #50
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 220 - 329
Target Start/End: Original strand, 4622100 - 4622209
Alignment:
220 tgttttcataagctatcctggagagcttatgaaaatgagtttaaaacagggtatgaacatgtcatgaactgttttcataagttctctcaaacagtctaac 319  Q
    ||||| |||| |||||| |||||||||| ||||||| || | |||||||  |||| ||||||||| |  ||||  ||| || |||  |||||||||||||    
4622100 tgtttccatatgctatcttggagagcttgtgaaaataagctaaaaacagcttatggacatgtcataagatgttcccattagatcttccaaacagtctaac 4622199  T
320 aagtgcttat 329  Q
    |||| |||||    
4622200 aagttcttat 4622209  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #51
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 289 - 362
Target Start/End: Complemental strand, 5886982 - 5886911
Alignment:
289 tgttttcataagttctctcaaacagtctaacaagtgcttatacaagaatagcctcaaataagtcaatccaaaca 362  Q
    ||||||||||||||||| ||||||||||  ||| ||||||| | |||  ||| |||||||||||||||||||||    
5886982 tgttttcataagttctc-caaacagtctcgcaattgcttatgccagataagc-tcaaataagtcaatccaaaca 5886911  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #52
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 288 - 329
Target Start/End: Original strand, 8382416 - 8382457
Alignment:
288 ctgttttcataagttctctcaaacagtctaacaagtgcttat 329  Q
    ||||||||||||||||||||||| ||||| |||| |||||||    
8382416 ctgttttcataagttctctcaaagagtctcacaaatgcttat 8382457  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #53
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 196 - 245
Target Start/End: Original strand, 23445317 - 23445366
Alignment:
196 attgtttttgtataataaataacttgttttcataagctatcctggagagc 245  Q
    |||||||||||||||   |||| |||||||||||||||||| ||||||||    
23445317 attgtttttgtataagccataagttgttttcataagctatcttggagagc 23445366  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #54
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 214 - 267
Target Start/End: Complemental strand, 26779994 - 26779941
Alignment:
214 ataacttgttttcataagctatcctggagagcttatgaaaatgagtttaaaaca 267  Q
    |||| |||||||||||||||||| || ||| ||||||||||| |||| ||||||    
26779994 ataagttgttttcataagctatcttgaagaacttatgaaaataagttgaaaaca 26779941  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #55
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 219 - 284
Target Start/End: Original strand, 30257689 - 30257754
Alignment:
219 ttgttttcataagctatcctggagagcttatgaaaatgagtttaaaacagggtatgaacatgtcat 284  Q
    |||||||||||| ||||||||||| ||||||  |||| || | |||||||  ||||||||||||||    
30257689 ttgttttcataaactatcctggagggcttatagaaataagctgaaaacagcttatgaacatgtcat 30257754  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #56
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 160 - 314
Target Start/End: Complemental strand, 33186082 - 33185927
Alignment:
160 ataagctatttttataacacaacataaaattaagtc--attgtttttgtataataaataacttgttttcataagctatcctggagagcttatgaaaatga 257  Q
    ||||||||||| ||| ||| || ||||||| | |||  ||||||||| || ||   |||| ||||||| |||||||||||| ||||  | ||| |||| |    
33186082 ataagctatttctattacagaagataaaataaggtcgaattgtttttatacaagttataagttgtttttataagctatcctagagatat-atgtaaataa 33185984  T
258 gtttaaaacagggtatgaacatgtcatgaactgttttcataagttctctcaaacagt 314  Q
    ||| |||||||| |||| | ||||||| |  |||||||||||  |||||||||||||    
33185983 gttgaaaacaggttatggaaatgtcataatttgttttcataaactctctcaaacagt 33185927  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #57
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 146 - 252
Target Start/End: Complemental strand, 33527286 - 33527178
Alignment:
146 ataagcgcttatggataagctatttttataacacaacataaaattaagtc--attgtttttgtataataaataacttgttttcataagctatcctggaga 243  Q
    ||||||||||||| ||||||||||| || |||| || |||||||  ||||  | ||||||  ||||||  ||||  |||||||||||| |||||| ||||    
33527286 ataagcgcttatgaataagctatttctaaaacaaaagataaaatacagtcaaactgttttcatataatctataagctgttttcataagttatcctcgaga 33527187  T
244 gcttatgaa 252  Q
     ||||||||    
33527186 tcttatgaa 33527178  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #58
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 271 - 324
Target Start/End: Complemental strand, 38170702 - 38170649
Alignment:
271 tatgaacatgtcatgaactgttttcataagttctctcaaacagtctaacaagtg 324  Q
    |||||||||||||| | ||||||||||||| |||| ||| |||||| |||||||    
38170702 tatgaacatgtcataagctgttttcataagctctcccaagcagtctcacaagtg 38170649  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #59
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 220 - 305
Target Start/End: Complemental strand, 39270488 - 39270403
Alignment:
220 tgttttcataagctatcctggagagcttatgaaaatgagtttaaaacagggtatgaacatgtcatgaactgttttcataagttctc 305  Q
    ||||||||||||||| | | |||||| ||||||||| |||| |||||||  |||| ||||| ||  | ||||||||||||| ||||    
39270488 tgttttcataagctaccatagagagcatatgaaaataagttgaaaacagcttatggacatgccaaaagctgttttcataagctctc 39270403  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #60
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 276 - 329
Target Start/End: Original strand, 42336678 - 42336731
Alignment:
276 acatgtcatgaactgttttcataagttctctcaaacagtctaacaagtgcttat 329  Q
    ||||||||| |  |||||||||||||| ||||||||||||  ||||||||||||    
42336678 acatgtcataagttgttttcataagttatctcaaacagtcgcacaagtgcttat 42336731  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #61
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 139 - 329
Target Start/End: Complemental strand, 44032145 - 44031953
Alignment:
139 ttatcatataagcgcttatggataagctatttttataacacaacataaaattaagtca--ttgtttttgtataataaataacttgttttcataagctatc 236  Q
    |||||||||||| | ||||| ||||||  ||| ||||||| ||  |||||| ||||||  |||||||  |||||   ||||  | ||||| |||| ||||    
44032145 ttatcatataagtgtttatgtataagccgtttctataacaaaagctaaaataaagtcaaattgttttcatataagctataaactattttcttaagttatc 44032046  T
237 ctggagagcttatgaaaatgagtttaaaacagggtatgaacatgtcatgaactgttttcataagttctctcaaacagtctaacaagtgcttat 329  Q
     || |||||||||| |||| || | |||| ||  |||| ||||||||| | ||| || |||||| ||||  | ||||||||||||||||||||    
44032045 ttgaagagcttatggaaattagctgaaaatagcttatggacatgtcattagctgcttacataagctctcctagacagtctaacaagtgcttat 44031953  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #62
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 137 - 194
Target Start/End: Original strand, 52286600 - 52286657
Alignment:
137 gcttatcatataagcgcttatggataagctatttttataacacaacataaaattaagt 194  Q
    |||||||||||||||||||||| ||||| ||||| || |||| || ||||||| ||||    
52286600 gcttatcatataagcgcttatgaataagatatttctacaacaaaagataaaataaagt 52286657  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #63
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 221 - 317
Target Start/End: Complemental strand, 5592028 - 5591932
Alignment:
221 gttttcataagctatcctggagagcttatgaaaatgagtttaaaacagggtatgaacatgtcatgaactgttttcataagttctctcaaacagtcta 317  Q
    ||||||||||| |||| | || | |||||| |||| | || ||||| |  |||| || |||||| | ||||||||||||| ||||||||||||||||    
5592028 gttttcataagatatcttagataacttatggaaataaattgaaaacggcttatgcacgtgtcataagctgttttcataagctctctcaaacagtcta 5591932  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #64
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 289 - 329
Target Start/End: Original strand, 36070257 - 36070297
Alignment:
289 tgttttcataagttctctcaaacagtctaacaagtgcttat 329  Q
    |||||||||||||||||  ||||||||| ||||||||||||    
36070257 tgttttcataagttctcctaaacagtctcacaagtgcttat 36070297  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #65
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 219 - 255
Target Start/End: Complemental strand, 37241886 - 37241850
Alignment:
219 ttgttttcataagctatcctggagagcttatgaaaat 255  Q
    ||||||||||||| |||||| ||||||||||||||||    
37241886 ttgttttcataagatatcctagagagcttatgaaaat 37241850  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #66
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 214 - 321
Target Start/End: Original strand, 49938748 - 49938856
Alignment:
214 ataacttgttttcataagctatcctggagagcttatgaaaatgagtttaaaacagggtatgaacat-gtcatgaactgttttcataagttctctcaaaca 312  Q
    |||| ||||||| |||||||||  | |||| ||||||||||| |||| |||| ||  | |||| || ||||| | |||||||||||||||||| ||||||    
49938748 ataagttgtttttataagctatattagagaacttatgaaaataagttgaaaaaagcttttgaaaattgtcataagctgttttcataagttctcccaaaca 49938847  T
313 gtctaacaa 321  Q
     ||| ||||    
49938848 atctcacaa 49938856  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 51; Significance: 5e-20; HSPs: 76)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 152 - 334
Target Start/End: Original strand, 39621890 - 39622072
Alignment:
152 gcttatggataagctatttttataacacaacataaaattaagtcattgtttttgtataataaataacttgttttcataagctatcctggagagcttatga 251  Q
    ||||||| ||||| ||||| |||||||||| ||||||| ||||||   ||||||||||||  ||||  |||||||||||| ||||| |   |||||| |     
39621890 gcttatgaataagatatttctataacacaaaataaaataaagtcaaactttttgtataatctataagctgttttcataagttatccggacaagcttaagg 39621989  T
252 aaatgagtttaaaacagggtatgaacatgtcatgaactgttttcataagttctctcaaacagtctaacaagtgcttatacaag 334  Q
    |||| || | ||||||   ||||||  |||||| |  |||||||||||||||||||||||||| |  ||||||||||||||||    
39621990 aaataagctgaaaacaatttatgaatttgtcataagttgttttcataagttctctcaaacagtgtcgcaagtgcttatacaag 39622072  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 219 - 329
Target Start/End: Complemental strand, 12313237 - 12313127
Alignment:
219 ttgttttcataagctatcctggagagcttatgaaaatgagtttaaaacagggtatgaacatgtcatgaactgttttcataagttctctcaaacagtctaa 318  Q
    |||||| ||||||||||| |||||||||||||||||| || | ||| ||   |||||||||| ||| | |||||||||||| ||||| |||||| ||| |    
12313237 ttgtttacataagctatcttggagagcttatgaaaataaggtgaaatcaacttatgaacatggcataagctgttttcataaattctcccaaacaatctca 12313138  T
319 caagtgcttat 329  Q
    |||||||||||    
12313137 caagtgcttat 12313127  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 196 - 302
Target Start/End: Original strand, 33941892 - 33941998
Alignment:
196 attgtttttgtataataaataacttgttttcataagctatcctggagagcttatgaaaatgagtttaaaacagggtatgaacatgtcatgaactgttttc 295  Q
    |||||||||||||||   ||||||||||||||||||||||| ||||||| |||||| ||| |||| ||| |||  ||||||| |||||| |  |||||||    
33941892 attgtttttgtataagttataacttgttttcataagctatcttggagagtttatgataataagttgaaagcagcttatgaacttgtcataagttgttttc 33941991  T
296 ataagtt 302  Q
    |||||||    
33941992 ataagtt 33941998  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 160 - 329
Target Start/End: Original strand, 787276 - 787448
Alignment:
160 ataagctatttttataacacaacataaaattaagtca--ttgtttttgtataataaataacttgtttt-cataagctatcctggagagcttatgaaaatg 256  Q
    ||||||||||| |||||||||| ||||||| ||||||  ||||||||||| |||  ||||  |||||| ||||| ||||| | ||  | ||||| | ||     
787276 ataagctatttctataacacaagataaaataaagtcaacttgtttttgtaaaatctataatctgtttttcataaactatcttagatggtttatggagata 787375  T
257 agtttaaaacagggtatgaacatgtcatgaactgttttcataagttctctcaaacagtctaacaagtgcttat 329  Q
    || | |||||||  |||| ||||||||| | |||||||||||||||||| |||||||| | ||||||||||||    
787376 agctgaaaacagcttatggacatgtcataagctgttttcataagttctcacaaacagtgtcacaagtgcttat 787448  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 223 - 316
Target Start/End: Original strand, 33192212 - 33192304
Alignment:
223 tttcataagctatcctggagagcttatgaaaatgagtttaaaacagggtatgaacatgtcatgaactgttttcataagttctctcaaacagtct 316  Q
    ||||||||||||||||||||||||||| || || || | |||||||  |||| | ||||||| ||||||||||||||||||| |||||||||||    
33192212 tttcataagctatcctggagagcttataaatataagctgaaaacagcttatggatatgtcataaactgttttcataagttct-tcaaacagtct 33192304  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 214 - 329
Target Start/End: Original strand, 35485918 - 35486033
Alignment:
214 ataacttgttttcataagctatcctggagagcttatgaaaatgagtttaaaacagggtatgaacatgtcatgaactgttttcataagttctctcaaacag 313  Q
    |||| ||||||| ||||||||||||| ||||| |||| ||||||| | |||||||  ||||||||| |||| |  || |||  |||||||||||||||||    
35485918 ataagttgtttttataagctatcctgaagagcctatggaaatgagctgaaaacagcttatgaacatatcataagttgctttagtaagttctctcaaacag 35486017  T
314 tctaacaagtgcttat 329  Q
    ||| |||||| |||||    
35486018 tctcacaagttcttat 35486033  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 198 - 329
Target Start/End: Original strand, 40158703 - 40158834
Alignment:
198 tgtttttgtataataaataacttgttttcataagctatcctggagagcttatgaaaatgagtttaaaacagggtatgaacatgtcatgaactgttttcat 297  Q
    |||||| ||||||  ||||| ||||||||||||| ||| |||||||||||||| || | || | ||||||   ||| |||||||||| | ||||||||||    
40158703 tgttttcgtataagcaataagttgttttcataagttattctggagagcttatgtaattaagctgaaaacaacttataaacatgtcataagctgttttcat 40158802  T
298 aagttctctcaaacagtctaacaagtgcttat 329  Q
    |||||| | ||| |||||| |||||| |||||    
40158803 aagttcccccaatcagtctcacaagttcttat 40158834  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #8
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 219 - 329
Target Start/End: Complemental strand, 38078474 - 38078364
Alignment:
219 ttgttttcataagctatcctggagagcttatgaaaatgagtttaaaacagggtatgaacatgtcatgaactgttttcataagttctctcaaacagtctaa 318  Q
    |||||||||||||||||| ||||||||||||| ||||||| | ||||||   |||||||||| | | |||| ||| |||||| ||||||| | ||||| |    
38078474 ttgttttcataagctatcttggagagcttatgtaaatgagctcaaaacaacttatgaacatgcctttaactatttccataagctctctcagatagtctca 38078375  T
319 caagtgcttat 329  Q
    | |||||||||    
38078374 ccagtgcttat 38078364  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #9
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 220 - 305
Target Start/End: Complemental strand, 35379079 - 35378994
Alignment:
220 tgttttcataagctatcctggagagcttatgaaaatgagtttaaaacagggtatgaacatgtcatgaactgttttcataagttctc 305  Q
    ||||||||||||||||| |||||||||||||||||| || | ||||||   |||||||| ||||| | ||||||||||||| ||||    
35379079 tgttttcataagctatcttggagagcttatgaaaataagctgaaaacaacttatgaacaagtcatcagctgttttcataagctctc 35378994  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #10
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 198 - 305
Target Start/End: Original strand, 42419982 - 42420089
Alignment:
198 tgtttttgtataataaataacttgttttcataagctatcctggagagcttatgaaaatgagtttaaaacagggtatgaacatgtcatgaactgttttcat 297  Q
    ||||||||||||||  ||||  | |||||||||||||||||||| |||||||| ||||||| | ||||||   |||||||||| ||| | || ||||| |    
42419982 tgtttttgtataatctataagctattttcataagctatcctggatagcttatggaaatgagctgaaaacaatttatgaacatgacataagcttttttcct 42420081  T
298 aagttctc 305  Q
    ||||||||    
42420082 aagttctc 42420089  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #11
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 196 - 321
Target Start/End: Original strand, 1625883 - 1626009
Alignment:
196 attgtttttgtataataaataacttgttttcataagctatcctggagagcttatgaaaatgagtttaaaacagggtatgaaca-tgtcatgaactgtttt 294  Q
    |||||||| ||||||   |||| |||||||||||||||||| |||||| |||| |||||| || | ||||||   |||||||| |||||| | ||  |||    
1625883 attgttttcgtataagttataagttgttttcataagctatcttggagaacttacgaaaatcagctgaaaacatcttatgaacattgtcataagctacttt 1625982  T
295 cataagttctctcaaacagtctaacaa 321  Q
    |||||||||||||||| ||||| ||||    
1625983 cataagttctctcaaatagtcttacaa 1626009  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #12
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 219 - 313
Target Start/End: Original strand, 15120189 - 15120283
Alignment:
219 ttgttttcataagctatcctggagagcttatgaaaatgagtttaaaacagggtatgaacatgtcatgaactgttttcataagttctctcaaacag 313  Q
    |||||||| ||||||||| |||||||||||| ||||| || |||||||||   ||||||||||||| |  ||||| |||||| |||| |||||||    
15120189 ttgttttcgtaagctatcatggagagcttatcaaaataagcttaaaacagctaatgaacatgtcataagttgtttccataagctctcccaaacag 15120283  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #13
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 153 - 268
Target Start/End: Original strand, 43259772 - 43259889
Alignment:
153 cttatggataagctatttttataacacaacataaaattaagtc--attgtttttgtataataaataacttgttttcataagctatcctggagagcttatg 250  Q
    |||| ||||||||||||| |||||||||| ||||||| |||||  || ||||||||||||| || ||  ||||||||| || |||| || ||||||||||    
43259772 cttacggataagctatttctataacacaagataaaataaagtcaaatagtttttgtataatcaacaagctgttttcattaggtatcttgaagagcttatg 43259871  T
251 aaaatgagtttaaaacag 268  Q
     |||| || | |||||||    
43259872 gaaataagctaaaaacag 43259889  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #14
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 220 - 284
Target Start/End: Complemental strand, 1939395 - 1939331
Alignment:
220 tgttttcataagctatcctggagagcttatgaaaatgagtttaaaacagggtatgaacatgtcat 284  Q
    |||||||||||||||| |||||||||||||| |||| |||| |||||||  |||| |||||||||    
1939395 tgttttcataagctatactggagagcttatggaaataagttgaaaacagcttatggacatgtcat 1939331  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #15
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 262 - 329
Target Start/End: Complemental strand, 5902570 - 5902503
Alignment:
262 aaaacagggtatgaacatgtcatgaactgttttcataagttctctcaaacagtctaacaagtgcttat 329  Q
    |||||||  |||||||||||||| | |||||||||||||||||  |||||||||| ||||||| ||||    
5902570 aaaacagtttatgaacatgtcataagctgttttcataagttcttccaaacagtctcacaagtgtttat 5902503  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #16
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 146 - 250
Target Start/End: Original strand, 10143103 - 10143209
Alignment:
146 ataagcgcttatggataagctatttttataacacaacataaaattaagtc--attgtttttgtataataaataacttgttttcataagctatcctggaga 243  Q
    ||||| ||||||| ||||| ||||| ||||||| || |||||||||||||  | ||||||| |||||   |||| || ||||||||||||||| ||||||    
10143103 ataagtgcttatgtataagttatttctataacaaaagataaaattaagtcaaactgtttttatataagctataagtttttttcataagctatcatggaga 10143202  T
244 gcttatg 250  Q
    | |||||    
10143203 gtttatg 10143209  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #17
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 234 - 363
Target Start/End: Complemental strand, 43529907 - 43529776
Alignment:
234 atcctggagagcttatgaaaatgagtttaaaacagggtatgaacatgtcatgaactgttttcataagttctctcaaacagtctaacaagtgcttata-ca 332  Q
    ||||| |||||||||||||||| |  | |||| ||  |||||||||| ||| | |||||||||||| ||||| |||||||| | | ||||||||||| ||    
43529907 atcctagagagcttatgaaaataaactgaaaatagcttatgaacatggcataagctgttttcataaattctcccaaacagtgtcagaagtgcttatacca 43529808  T
333 aga-atagcctcaaataagtcaatccaaacag 363  Q
    | | |||  ||||||||||||||| |||||||    
43529807 atagataagctcaaataagtcaattcaaacag 43529776  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #18
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 271 - 329
Target Start/End: Original strand, 1801726 - 1801784
Alignment:
271 tatgaacatgtcatgaactgttttcataagttctctcaaacagtctaacaagtgcttat 329  Q
    |||||||||||||| | |||||||||||||||||| |||||| | | ||||||||||||    
1801726 tatgaacatgtcataagctgttttcataagttctcccaaacaatatcacaagtgcttat 1801784  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #19
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 271 - 329
Target Start/End: Original strand, 4350748 - 4350806
Alignment:
271 tatgaacatgtcatgaactgttttcataagttctctcaaacagtctaacaagtgcttat 329  Q
    |||||||||||||| | ||||||||||||||||||||||||| |||   ||||||||||    
4350748 tatgaacatgtcataagctgttttcataagttctctcaaacaatctcttaagtgcttat 4350806  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #20
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 214 - 260
Target Start/End: Original strand, 9477953 - 9477999
Alignment:
214 ataacttgttttcataagctatcctggagagcttatgaaaatgagtt 260  Q
    |||| |||||||||||||||||||||||||| |||||||||| ||||    
9477953 ataagttgttttcataagctatcctggagaggttatgaaaataagtt 9477999  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #21
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 222 - 284
Target Start/End: Complemental strand, 34652097 - 34652035
Alignment:
222 ttttcataagctatcctggagagcttatgaaaatgagtttaaaacagggtatgaacatgtcat 284  Q
    ||||||||||||||| ||||||||||||| |||| |||| |||||||  |||| |||||||||    
34652097 ttttcataagctatcttggagagcttatggaaataagttgaaaacagcttatggacatgtcat 34652035  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #22
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 214 - 260
Target Start/End: Complemental strand, 36863694 - 36863648
Alignment:
214 ataacttgttttcataagctatcctggagagcttatgaaaatgagtt 260  Q
    |||| |||||||||||||||||| |||||||||||||||||| ||||    
36863694 ataaattgttttcataagctatcttggagagcttatgaaaataagtt 36863648  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #23
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 138 - 329
Target Start/End: Original strand, 11513824 - 11514012
Alignment:
138 cttatcatataagcgcttatggataagctatttttataacacaacataaaattaagtca--ttgtttttgtataataaataacttgttttcataagctat 235  Q
    ||||||||||||| | ||||| ||||| ||||   | |||| || ||||||| ||||||  |||||||  |||||   |||| |||||||||||||||||    
11513824 cttatcatataagggtttatgtataagttatt---acaacaaaagataaaataaagtcaaattgttttcatataagctataagttgttttcataagctat 11513920  T
236 cctggagagcttatgaaaatgagtttaaaacagggtatgaacatgtcatgaactgttttcataagttctctcaaacagtctaacaagtgcttat 329  Q
    | |||||| ||| || |||| || | |||| ||  |||   |||| ||||  ||||||||||||| ||||| ||||||||| ||||||||||||    
11513921 catggagaacttttggaaataagctgaaaatagcttataggcatgccatg--ctgttttcataagctctctaaaacagtctcacaagtgcttat 11514012  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #24
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 245 - 314
Target Start/End: Original strand, 13220465 - 13220534
Alignment:
245 cttatgaaaatgagtttaaaacagggtatgaacatgtcatgaactgttttcataagttctctcaaacagt 314  Q
    |||||| |||| ||||||||||||  |||||||| ||||| |  |||||| |||||||||||||||||||    
13220465 cttatgcaaataagtttaaaacagcttatgaacaagtcataagttgtttttataagttctctcaaacagt 13220534  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #25
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 220 - 329
Target Start/End: Original strand, 16867746 - 16867854
Alignment:
220 tgttttcataagctatcctggagagcttatgaaaatgagtttaaaacagggtatgaacatgtcatgaactgttttcataagttctctcaaacagtctaac 319  Q
    |||||||| |||||||| ||||||||||||| |||| |||| ||||||   |||||| ||||||| ||||   ||| |||| ||||| ||||||| | ||    
16867746 tgttttcacaagctatcttggagagcttatggaaataagttgaaaacaacttatgaatatgtcataaact-acttcttaagctctctaaaacagtgtcac 16867844  T
320 aagtgcttat 329  Q
    ||||||||||    
16867845 aagtgcttat 16867854  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #26
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 223 - 316
Target Start/End: Complemental strand, 32106859 - 32106766
Alignment:
223 tttcataagctatcctggagagcttatgaaaatgagtttaaaacagggtatgaacatgtcatgaactgttttcataagttctctcaaacagtct 316  Q
    ||||||||| ||||||| |||||||||||| || | || |||||||  ||   | ||||||| | |||||||||||||||||| ||||||||||    
32106859 tttcataagttatcctgaagagcttatgaacataatttgaaaacagcttacagatatgtcataagctgttttcataagttctcacaaacagtct 32106766  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #27
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 221 - 310
Target Start/End: Original strand, 33256748 - 33256837
Alignment:
221 gttttcataagctatcctggagagcttatgaaaatgagtttaaaacagggtatgaacatgtcatgaactgttttcataagttctctcaaa 310  Q
    |||||||||||| |||||| ||| | ||||||||| || | | |||||  |||||||||||||| | ||||||||||||| |||| ||||    
33256748 gttttcataagccatcctgaagaccgtatgaaaataagctgagaacagtttatgaacatgtcataagctgttttcataagctctcccaaa 33256837  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #28
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 235 - 312
Target Start/End: Original strand, 38809348 - 38809425
Alignment:
235 tcctggagagcttatgaaaatgagtttaaaacagggtatgaacatgtcatgaactgttttcataagttctctcaaaca 312  Q
    |||||||||||||||| |||| |||| |||||||  ||| |||||||||| | ||| ||| |||||||||| ||||||    
38809348 tcctggagagcttatggaaataagttgaaaacagattattaacatgtcataagctggtttaataagttctcccaaaca 38809425  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #29
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 214 - 255
Target Start/End: Original strand, 39983343 - 39983384
Alignment:
214 ataacttgttttcataagctatcctggagagcttatgaaaat 255  Q
    |||| |||||||||||||||||||||||||||| ||||||||    
39983343 ataagttgttttcataagctatcctggagagctaatgaaaat 39983384  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #30
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 155 - 268
Target Start/End: Original strand, 4090289 - 4090404
Alignment:
155 tatggataagctatttttataacacaacataaaattaagtc--attgtttttgtataataaataacttgttttcataagctatcctggagagcttatgaa 252  Q
    |||| |||||||||||  ||||||||| ||||||| |||||  |||||||  |||||||  |||| |||||| ||||||||||||  ||||||| ||| |    
4090289 tatgaataagctatttccataacacaagataaaataaagtcaaattgtttcggtataatctataagttgtttacataagctatccctgagagctcatgga 4090388  T
253 aatgagtttaaaacag 268  Q
    |||  ||| |||||||    
4090389 aatatgttgaaaacag 4090404  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #31
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 219 - 323
Target Start/End: Complemental strand, 6993788 - 6993684
Alignment:
219 ttgttttcataagctatcctggagagcttatgaaaatgagtttaaaacagggtatgaacatgtcatgaactgttttcataagttctctcaaacagtctaa 318  Q
    ||||||||||||||||| || |||||||||||||||| || | ||||     |||| ||||| ||| | || ||| |||||||||| ||||||||||| |    
6993788 ttgttttcataagctatgcttgagagcttatgaaaataagctaaaaatgacttatggacatgccataagctatttacataagttctatcaaacagtctca 6993689  T
319 caagt 323  Q
    |||||    
6993688 caagt 6993684  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #32
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 220 - 260
Target Start/End: Complemental strand, 10884584 - 10884544
Alignment:
220 tgttttcataagctatcctggagagcttatgaaaatgagtt 260  Q
    ||||||||||||||||||| |||||||||||||||| ||||    
10884584 tgttttcataagctatcctagagagcttatgaaaataagtt 10884544  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #33
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 214 - 321
Target Start/End: Original strand, 20952356 - 20952464
Alignment:
214 ataacttgttttcataagctatcctggagagcttatgaaaatgagtttaaaacagggtatgaacat-gtcatgaactgttttcataagttctctcaaaca 312  Q
    |||| ||||||| || ||||||  |||||| ||||||||||| |||| |||| ||   ||||| || | ||| ||||||||||||||||||||| ||| |    
20952356 ataagttgtttttattagctatattggagaacttatgaaaataagttgaaaaaagttaatgaaaattggcataaactgttttcataagttctcttaaata 20952455  T
313 gtctaacaa 321  Q
    |||||||||    
20952456 gtctaacaa 20952464  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #34
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 219 - 255
Target Start/End: Original strand, 24097814 - 24097850
Alignment:
219 ttgttttcataagctatcctggagagcttatgaaaat 255  Q
    ||||||||||||| |||||||||||||||||||||||    
24097814 ttgttttcataagttatcctggagagcttatgaaaat 24097850  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #35
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 238 - 363
Target Start/End: Complemental strand, 28677704 - 28677577
Alignment:
238 tggagagcttatgaaaatgagtttaaaacagggtatgaacatgtcatgaactgttttcataagttctctcaaacagtctaacaagtgcttatacaag--a 335  Q
    ||||||||||||| |||| ||   ||||||   |||||| ||||||| | |||||||||||||||||| |||||||||| |  ||| ||||| ||||  |    
28677704 tggagagcttatggaaataagccgaaaacaacttatgaaaatgtcataagctgttttcataagttctcccaaacagtcttagcagtacttatgcaagtaa 28677605  T
336 atagcctcaaataagtcaatccaaacag 363  Q
    |||  |||||| || |||||||||||||    
28677604 ataagctcaaaaaaatcaatccaaacag 28677577  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #36
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 144 - 313
Target Start/End: Original strand, 28933753 - 28933923
Alignment:
144 atataagcgcttatggataagctatttttataacacaacataaaattaagtca--ttgtttttgtataataaataacttgttttcataagctatcctgga 241  Q
    ||||||| ||| ||| ||||||||||| ||||||| || ||||||| || |||  || ||||  | |||   |||| |||||||||||||||||||| ||    
28933753 atataagtgctcatgtataagctatttatataacaaaagataaaatcaaatcaaattattttcatttaagttataaattgttttcataagctatcctaga 28933852  T
242 gagcttatgaaaatgagtttaaaacagggtatgaacatgtcatgaactgttttcataagttctctcaaacag 313  Q
    ||||| ||  |||| |||| |||||| | |||||||||| ||| |  |||||||||||| |||  |||||||    
28933853 gagctgatagaaataagttgaaaaca-gctatgaacatgccataagttgttttcataagctcttccaaacag 28933923  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #37
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 245 - 305
Target Start/End: Original strand, 31096333 - 31096393
Alignment:
245 cttatgaaaatgagtttaaaacagggtatgaacatgtcatgaactgttttcataagttctc 305  Q
    ||||||||||| ||||||||||||  |||| |||||| || ||||||||||||||| ||||    
31096333 cttatgaaaataagtttaaaacagcttatggacatgttattaactgttttcataagctctc 31096393  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #38
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 222 - 314
Target Start/End: Original strand, 41817177 - 41817269
Alignment:
222 ttttcataagctatcctggagagcttatgaaaatgagtttaaaacagggtatgaacatgtcatgaactgttttcataagttctctcaaacagt 314  Q
    ||||||||| ||||||||||||||||||| |||| || | ||||||   ||| |||||||||| |  ||||||||||| |||||  |||||||    
41817177 ttttcataaactatcctggagagcttatggaaataagctgaaaacaaattatcaacatgtcataagatgttttcataaattctcctaaacagt 41817269  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #39
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 224 - 296
Target Start/End: Complemental strand, 44438898 - 44438826
Alignment:
224 ttcataagctatcctggagagcttatgaaaatgagtttaaaacagggtatgaacatgtcatgaactgttttca 296  Q
    |||||||| ||||||||||| ||| || |||| || | |||||||| |||||||||||||| | |||||||||    
44438898 ttcataagttatcctggagatcttgtggaaataagctgaaaacaggttatgaacatgtcataagctgttttca 44438826  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #40
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 223 - 321
Target Start/End: Original strand, 750680 - 750779
Alignment:
223 tttcataagctatcctggagagcttatgaaaatgagtttaaaacagggtatgaac-atgtcatgaactgttttcataagttctctcaaacagtctaacaa 321  Q
    |||||||||||||| |||||| |||||| |||| || | |||||||  ||||||| ||||||| | || ||||||||||||||  |||||| ||| ||||    
750680 tttcataagctatcttggagaacttatgcaaataagctcaaaacagcttatgaacaatgtcattagctcttttcataagttcttgcaaacactctcacaa 750779  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #41
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 223 - 314
Target Start/End: Complemental strand, 1494506 - 1494415
Alignment:
223 tttcataagctatcctggagagcttatgaaaatgagtttaaaacagggtatgaacatgtcatgaactgttttcataagttctctcaaacagt 314  Q
    |||||| ||| ||| ||| ||| || ||||||| || | |||||||  |||| ||||||||| | ||||||||||||| |||||||||||||    
1494506 tttcattagccatcatggcgaggttttgaaaataagctaaaaacagtttatggacatgtcataagctgttttcataagctctctcaaacagt 1494415  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #42
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 220 - 255
Target Start/End: Original strand, 3049981 - 3050016
Alignment:
220 tgttttcataagctatcctggagagcttatgaaaat 255  Q
    ||||||||||||||||| ||||||||||||||||||    
3049981 tgttttcataagctatcatggagagcttatgaaaat 3050016  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #43
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 222 - 253
Target Start/End: Complemental strand, 9530789 - 9530758
Alignment:
222 ttttcataagctatcctggagagcttatgaaa 253  Q
    ||||||||||||||||||||||||||||||||    
9530789 ttttcataagctatcctggagagcttatgaaa 9530758  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #44
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 227 - 298
Target Start/End: Original strand, 25790140 - 25790211
Alignment:
227 ataagctatcctggagagcttatgaaaatgagtttaaaacagggtatgaacatgtcatgaactgttttcata 298  Q
    |||| |||||||||||||||||||||||| |||| |||||||  || |||||||| || | |||||| ||||    
25790140 ataatctatcctggagagcttatgaaaataagttcaaaacagcttaggaacatgtaataagctgtttccata 25790211  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #45
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 288 - 331
Target Start/End: Original strand, 32837398 - 32837441
Alignment:
288 ctgttttcataagttctctcaaacagtctaacaagtgcttatac 331  Q
    |||||||||||||||||| |||||||||| |||||| |||||||    
32837398 ctgttttcataagttctcccaaacagtctcacaagtacttatac 32837441  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #46
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 196 - 255
Target Start/End: Original strand, 40279180 - 40279239
Alignment:
196 attgtttttgtataataaataacttgttttcataagctatcctggagagcttatgaaaat 255  Q
    |||||||| |||||| | |||| |||||||||||||||||  |||||| |||||||||||    
40279180 attgttttggtataagatataagttgttttcataagctatgttggagaacttatgaaaat 40279239  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #47
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 342 - 372
Target Start/End: Original strand, 4508312 - 4508342
Alignment:
342 tcaaataagtcaatccaaacaggtcgtaagt 372  Q
    |||||||||||||||||||||||||||||||    
4508312 tcaaataagtcaatccaaacaggtcgtaagt 4508342  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #48
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 138 - 196
Target Start/End: Complemental strand, 17952848 - 17952790
Alignment:
138 cttatcatataagcgcttatggataagctatttttataacacaacataaaattaagtca 196  Q
    ||||||||||||| ||||||  ||||||||||| ||||||| || ||||||| ||||||    
17952848 cttatcatataagagcttatatataagctatttctataacaaaagataaaataaagtca 17952790  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #49
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 214 - 284
Target Start/End: Original strand, 33942151 - 33942221
Alignment:
214 ataacttgttttcataagctatcctggagagcttatgaaaatgagtttaaaacagggtatgaacatgtcat 284  Q
    |||| |||||||||||||| ||| | ||||||| |||||||| || | |||||||  ||||||||||||||    
33942151 ataagttgttttcataagccatcatagagagctaatgaaaattagctgaaaacagcttatgaacatgtcat 33942221  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #50
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 214 - 268
Target Start/End: Original strand, 40279408 - 40279462
Alignment:
214 ataacttgttttcataagctatcctggagagcttatgaaaatgagtttaaaacag 268  Q
    |||| |||||||||||||||||  |||||| ||||||||||| |||| |||||||    
40279408 ataagttgttttcataagctatattggagaacttatgaaaataagttgaaaacag 40279462  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #51
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 153 - 254
Target Start/End: Complemental strand, 43299535 - 43299430
Alignment:
153 cttatggataagctatttttataacacaacataaaattaagtcat--tgtttttgtataa-taaataacttgttttcataagct-atcctggagagctta 248  Q
    |||||| || |||||||| ||||||| || ||||||| ||||||   ||||||||||||| |  |||| ||||||||||||||| ||||||| ||||| |    
43299535 cttatgaattagctatttatataacagaagataaaataaagtcaaactgtttttgtataaatctataagttgttttcataagctaatcctggtgagctca 43299436  T
249 tgaaaa 254  Q
    ||||||    
43299435 tgaaaa 43299430  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #52
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 224 - 305
Target Start/End: Original strand, 43570425 - 43570506
Alignment:
224 ttcataagctatcctggagagcttatgaaaatgagtttaaaacagggtatgaac-atgtcatgaactgttttcataagttctc 305  Q
    ||||||||| |||||||| ||||||||||||| ||  ||||| ||  ||||||| ||||||| | ||||||||||||||||||    
43570425 ttcataagccatcctggaaagcttatgaaaataag-ctaaaaaagcttatgaacaatgtcataagctgttttcataagttctc 43570506  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #53
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 222 - 299
Target Start/End: Original strand, 680512 - 680589
Alignment:
222 ttttcataagctatcctggagagcttatgaaaatgagtttaaaacagggtatgaacatgtcatgaactgttttcataa 299  Q
    ||||||||||||||| || ||| ||| ||||||| || | |||||||  ||| |||||||||| | ||||||||||||    
680512 ttttcataagctatcttgaagaacttgtgaaaataagctgaaaacagtttataaacatgtcataagctgttttcataa 680589  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #54
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 276 - 329
Target Start/End: Original strand, 1318299 - 1318352
Alignment:
276 acatgtcatgaactgttttcataagttctctcaaacagtctaacaagtgcttat 329  Q
    ||||||||| |  |||||||||||| |||| |||||||||| ||||||||||||    
1318299 acatgtcataagatgttttcataagctctcacaaacagtctcacaagtgcttat 1318352  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #55
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 227 - 304
Target Start/End: Original strand, 1647250 - 1647327
Alignment:
227 ataagctatcctggagagcttatgaaaatgagtttaaaacagggtatgaacatgtcatgaactgttttcataagttct 304  Q
    |||||||||  | ||||||||||| |||| || | |||||||  ||||| |||||||| | |||||||||||||||||    
1647250 ataagctattatagagagcttatggaaataagctgaaaacagcttatgagcatgtcataagctgttttcataagttct 1647327  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #56
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 139 - 196
Target Start/End: Original strand, 3102617 - 3102674
Alignment:
139 ttatcatataagcgcttatggataagctatttttataacacaacataaaattaagtca 196  Q
    |||||||||||  ||||||| |||||||||||||||| || || ||||||| ||||||    
3102617 ttatcatataactgcttatgtataagctatttttatagcaaaatataaaataaagtca 3102674  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #57
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 220 - 305
Target Start/End: Original strand, 9556246 - 9556331
Alignment:
220 tgttttcataagctatcctggagagcttatgaaaatgagtttaaaacagggtatgaacatgtcatgaactgttttcataagttctc 305  Q
    ||||||||||||||||||| || ||||||||||||| ||||&nbs