View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0095_low_13 (Length: 489)

Name: NF0095_low_13
Description: NF0095
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF0095_low_13
[»] chr3 (1 HSPs)
chr3 (30-485)||(780462-780905)

Alignment Details
Target: chr3 (Bit Score: 362; Significance: 0; HSPs: 1)
Name: chr3

Target: chr3; HSP #1
Raw Score: 362; E-Value: 0
Query Start/End: Original strand, 30 - 485
Target Start/End: Original strand, 780462 - 780905
30 ggaatttgcagacatggagcataccaatgaaagtggaaagtggaaggcgcgcggaaggagatgttgggggaaagaagagaagataaagaaaatttagtgt 129  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||    |||||||||||||||||||||||||||||||||||||||||||||||    
780462 ggaatttgcagacatggagcataccaatgaaagtggaaagtggaaggcg----gaaggagatgttgggggaaagaagagaagataaagaaaatttagtgt 780557  T
130 ggataatgtccacaacatttcgatctttaattaatctaataataagaaaaagttagttatgcaccatacaacacttgatttagttgtgcacatgtagcca 229  Q
    |||| ||||||||||||||||||||||||||    ||||||||||||||||||||    |||||||||||||| ||||||||||||||||||||||||||    
780558 ggatgatgtccacaacatttcgatctttaat----ctaataataagaaaaagtta----tgcaccatacaacatttgatttagttgtgcacatgtagcca 780649  T
230 cttgacaaatttggaggatcaatgttgcagtcgcatggaattagattttagcaacaaatgatcactatagcaagttctctcgatgaaacattgtagagag 329  Q
    |||||||| | ||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||| ||||    
780650 cttgacaattatggaggatcaatgttgcagtcgcatggaattagattttagcgacaaatgatca-tatagcaagttctctcgatgaaacattgtatagag 780748  T
330 aatcc-taaaaacaaagaagaaaaatgaccattaaatttcaataataggccatatcaatggctttatccctcaagtttcttgctgaatttgatgtttttc 428  Q
    || || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
780749 aaaccctaaaaacaaagaagaaaaatgaccattaaatttcaataataggccatatcaatggctttatccctcaagtttcttgctgaatttgatgtttttc 780848  T
429 atctgatgtttaaatttttcctcttcaacgtgtacttgagaatatttcttctcactc 485  Q
780849 atctgatgtttaaatttttcctcttcaacgtgtacttgagaatatttcttctcactc 780905  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 151098 times since January 2019
Visitors: 1526