View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0095_low_14 (Length: 486)

Name: NF0095_low_14
Description: NF0095
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0095_low_14
NF0095_low_14
[»] chr2 (3 HSPs)
chr2 (22-172)||(28825782-28825932)
chr2 (329-391)||(28825635-28825697)
chr2 (290-327)||(4614338-4614375)
[»] chr3 (1 HSPs)
chr3 (270-328)||(28957774-28957832)


Alignment Details
Target: chr2 (Bit Score: 135; Significance: 4e-70; HSPs: 3)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 135; E-Value: 4e-70
Query Start/End: Original strand, 22 - 172
Target Start/End: Complemental strand, 28825932 - 28825782
Alignment:
22 gttgaataacatgtgagtggcacgtgactggtcaattgttttaatataaagtcaatgatcagcaaaagatgtggggatcttggacttggggcatgcgttg 121  Q
    |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||    
28825932 gttgaatagcatgtgagtggcacgtgactggtcaattgttttaatataaagtcaatgatcagcaaaagaggtggggatcttggacttggggcatgcgttg 28825833  T
122 ttactttagaatctcaatttcaattttaattattttaatgatacatgtcac 172  Q
    |||||||||||||||||||||| |||||||||||||||||| |||||||||    
28825832 ttactttagaatctcaatttcatttttaattattttaatgaaacatgtcac 28825782  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 329 - 391
Target Start/End: Complemental strand, 28825697 - 28825635
Alignment:
329 caagaatgagggagagccataaaattttattttaattttatacgaagcaagagccataatact 391  Q
    |||||| |||||||||||||||||||||||||||||||||||| ||||||||||| |||||||    
28825697 caagaaagagggagagccataaaattttattttaattttatacaaagcaagagccttaatact 28825635  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 290 - 327
Target Start/End: Complemental strand, 4614375 - 4614338
Alignment:
290 cattgattaagaaatcaaatgtagtaaatattacatta 327  Q
    |||||||||||||| |||||||||||| ||||||||||    
4614375 cattgattaagaaagcaaatgtagtaagtattacatta 4614338  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 35; Significance: 0.0000000002; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 270 - 328
Target Start/End: Complemental strand, 28957832 - 28957774
Alignment:
270 gttaattgatgtttatggaacattgattaagaaatcaaatgtagtaaatattacattaa 328  Q
    |||||| ||||||||||||||| |||||||| ||| |||| || |||||||||||||||    
28957832 gttaatcgatgtttatggaacactgattaaggaattaaatataataaatattacattaa 28957774  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 151013 times since January 2019
Visitors: 1525