View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0095_low_15 (Length: 481)

Name: NF0095_low_15
Description: NF0095
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0095_low_15
NF0095_low_15
[»] chr3 (3 HSPs)
chr3 (221-324)||(49032768-49032871)
chr3 (405-466)||(49032624-49032685)
chr3 (405-473)||(41055024-41055095)
[»] chr8 (1 HSPs)
chr8 (405-473)||(42640418-42640489)
[»] chr7 (2 HSPs)
chr7 (86-120)||(43849846-43849880)
chr7 (259-300)||(30514632-30514673)


Alignment Details
Target: chr3 (Bit Score: 88; Significance: 4e-42; HSPs: 3)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 88; E-Value: 4e-42
Query Start/End: Original strand, 221 - 324
Target Start/End: Complemental strand, 49032871 - 49032768
Alignment:
221 gatgattgtttagttgtttggtagggatgaaagtgaagaggaaagaaagagatataaatagtaaatgacaaaaataccctaatataaaaatgatttatgt 320  Q
    |||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||| |||    
49032871 gatgattgtttagttgtttggtaggggtgaaagtgaagaggaaagaaagatatataaatagtaaatgacaaaaataccctaatataaaagtgatttgtgt 49032772  T
321 gtgt 324  Q
    ||||    
49032771 gtgt 49032768  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 405 - 466
Target Start/End: Complemental strand, 49032685 - 49032624
Alignment:
405 gtaaaggaaatacaaacattagattatttcaaataaaggaacacaaacgttaaaagaaatat 466  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||    
49032685 gtaaaggaaatacaaacattggattatttcaaataaaggaacacaaacgttaaaagaaatat 49032624  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 405 - 473
Target Start/End: Complemental strand, 41055095 - 41055024
Alignment:
405 gtaaaggaaatacaaacattagattatttcaaat-aaaggaacacaaacgttaaaa--gaaatattcatctc 473  Q
    ||||||||| || |||| |||||||||||||||| |||  ||||||||||||||||  |||||||| |||||    
41055095 gtaaaggaagtaaaaacgttagattatttcaaataaaaaaaacacaaacgttaaaaatgaaatatttatctc 41055024  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 33; Significance: 0.000000003; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 405 - 473
Target Start/End: Original strand, 42640418 - 42640489
Alignment:
405 gtaaaggaaatacaaacattagattatttcaaat-aaaggaacacaaacgttaaaa--gaaatattcatctc 473  Q
    ||||||||| || |||| |||||||||||||||| |||| ||||||||||||||||  |||||||| |||||    
42640418 gtaaaggaagtaaaaacgttagattatttcaaataaaagaaacacaaacgttaaaaatgaaatatttatctc 42640489  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 31; Significance: 0.00000004; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 86 - 120
Target Start/End: Original strand, 43849846 - 43849880
Alignment:
86 gaacaacgactcgaacaccattgactatgccaact 120  Q
    ||||||||||||||||||||||||||||| |||||    
43849846 gaacaacgactcgaacaccattgactatgtcaact 43849880  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 259 - 300
Target Start/End: Complemental strand, 30514673 - 30514632
Alignment:
259 aggaaagaaagagatataaatagtaaatgacaaaaataccct 300  Q
    |||||||||||| |||||  ||||||||||||||||||||||    
30514673 aggaaagaaagatatatatttagtaaatgacaaaaataccct 30514632  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 126450 times since January 2019
Visitors: 1390