View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0095_low_18 (Length: 472)

Name: NF0095_low_18
Description: NF0095
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF0095_low_18
[»] chr7 (2 HSPs)
chr7 (11-443)||(38937390-38937822)
chr7 (11-396)||(39305177-39305562)

Alignment Details
Target: chr7 (Bit Score: 255; Significance: 1e-142; HSPs: 2)
Name: chr7

Target: chr7; HSP #1
Raw Score: 255; E-Value: 1e-142
Query Start/End: Original strand, 11 - 443
Target Start/End: Original strand, 38937390 - 38937822
11 cagagaaatggtttcctgaaaggtctaactctgtcatttcctttaagtttccaaactcttcaggaatgggaccggagaaaagatttttgtagagaaaaag 110  Q
    ||||||| ||||||||||||||||||||| |||||||| |||| |||||||| | ||| ||||| || ||||| || || | ||| ||||| ||||  |     
38937390 cagagaagtggtttcctgaaaggtctaaccctgtcattaccttcaagtttcctatctcatcagggattggaccagacaacatattattgtacagaagtaa 38937489  T
111 aattttaannnnnnncaacaagccaatttgtggaggaatcattcctgttaacctannnnnnnggagttgcaaagaagttaactcagtccaattagagatc 210  Q
     ||| |||       ||  |||||||| |||||||| | | |||| ||||| |||       |||||||||| ||||||||||  ||||||||||| | |    
38937490 gattataatttttttcagtaagccaatctgtggaggtagctttccagttaaactattgttttggagttgcaaggaagttaacttggtccaattagatacc 38937589  T
211 aatgaagctgaaatttgaccagaaaaagaattatccgataatcctagttctgatagtttagtcaaatttgctaatgacaaaggcaaagaacctgtcaggt 310  Q
38937590 aatgaagctgaaatttgaccagaaaaagaattatccgataatcctagttctgatagtttagtcaaatttgctaatgacaaaggcaaagaacctgtcaggt 38937689  T
311 tatttactgctaagctcaagaaagttagatttgtgcataggccaagctcagaaggaactttagagttcaaaaagttagcactgagatcaagatgcaccaa 410  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||    
38937690 tatttactgctaagctcaagaaagttagatttgtgcataggccaagctcagaaggaactttagagttcaaaaagttagcactgagatcaagatgcactaa 38937789  T
411 ctcctttagttgacctatggaagaaggaatttc 443  Q
38937790 ctcctttagttgacctatggaagaaggaatttc 38937822  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 11 - 396
Target Start/End: Complemental strand, 39305562 - 39305177
11 cagagaaatggtttcctgaaaggtctaactctgtcatttcctttaagtttccaaactcttcaggaatgggaccggagaaaagatttttgtagagaaaaag 110  Q
    ||||||| ||||||||||||||||||||| |||||||| |||| |||||||| | ||| ||||| || ||||| || || | ||| ||||| ||||  |     
39305562 cagagaagtggtttcctgaaaggtctaaccctgtcattaccttcaagtttcctatctcatcagggattggaccagacaacatattattgtacagaagtaa 39305463  T
111 aattttaannnnnnncaacaagccaatttgtggaggaatcattcctgttaacctannnnnnnggagttgcaaagaagttaactcagtccaattagagatc 210  Q
     ||| |||       ||  |||||||| |||||||| | | |||| ||||| |||       |||||||||| ||||||||||  ||||||||||| | |    
39305462 gattataatttttttcagtaagccaatctgtggaggtagctttccagttaaactattgttttggagttgcaaggaagttaacttggtccaattagatacc 39305363  T
211 aatgaagctgaaatttgaccagaaaaagaattatccgataatcctagttctgatagtttagtcaaatttgctaatgacaaaggcaaagaacctgtcaggt 310  Q
39305362 aatgaagctgaaatttgaccagaaaaagaattatccgataatcctagttctgatagtttagtcaaatttgctaatgacaaaggcaaagaacctgtcaggt 39305263  T
311 tatttactgctaagctcaagaaagttagatttgtgcataggccaagctcagaaggaactttagagttcaaaaagttagcactgaga 396  Q
39305262 tatttactgctaagctcaagaaagttagatttgtgcataggccaagctcagaaggaactttagagttcaaaaagttagcactgaga 39305177  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 150614 times since January 2019
Visitors: 1522