View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0095_low_20 (Length: 469)

Name: NF0095_low_20
Description: NF0095
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0095_low_20
NF0095_low_20
[»] chr6 (2 HSPs)
chr6 (7-264)||(13726433-13726690)
chr6 (304-440)||(13726980-13727118)
[»] chr3 (1 HSPs)
chr3 (385-435)||(49525056-49525106)


Alignment Details
Target: chr6 (Bit Score: 230; Significance: 1e-127; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 7 - 264
Target Start/End: Original strand, 13726433 - 13726690
Alignment:
7 agcatagggtttatgtggccttgtaatggatacggtaacactaagatgtgtggtgcatgttttttgcttttattctccattgatttttgtggtgtctctt 106  Q
    ||||||||||||||||| |||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
13726433 agcatagggtttatgtgaccttgtaatggatatggaaacactaagatgtgtggtgcatgttttttgcttttattctccattgatttttgtggtgtctctt 13726532  T
107 ttcttctggaatgtgtttatatatgaagaagggtgtaaaagtaatagacataatgatattctaatcaatgaatccattgaacaaaaaagattgcaaagca 206  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||    
13726533 ttcttctggaatgtgtttatatatgaagaagggtgtaaaagtaatagacataatgatattctaatcaatgaatgcattgaacaaaaaagatagcaaagca 13726632  T
207 tcaattgattgtgacctttccatgtaggatttagaccttttcctaatgtggtgtggca 264  Q
    |||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||    
13726633 tcaagtgattgtgacctttccatgtaggattttgaccttttcctaatgtggtgtggca 13726690  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 90; E-Value: 3e-43
Query Start/End: Original strand, 304 - 440
Target Start/End: Original strand, 13726980 - 13727118
Alignment:
304 caccaacatcgagcatttcaatagaaggaagaacaacaatgccaacttggggaaannnnnnn-atattgtagcaaaagatgttcaatacaaggaggataa 402  Q
    ||||||||||||||||||||||||||||||| |||||||||||||||||||||||        |||||||||||||||||||||||||||||||||||||    
13726980 caccaacatcgagcatttcaatagaaggaaggacaacaatgccaacttggggaaactttttttatattgtagcaaaagatgttcaatacaaggaggataa 13727079  T
403 ttctcaaaaa-tatggggacaagaccaagaacaggtcgc 440  Q
    |||||||||| || || ||||||||||||||||||||||    
13727080 ttctcaaaaattacggtgacaagaccaagaacaggtcgc 13727118  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 385 - 435
Target Start/End: Original strand, 49525056 - 49525106
Alignment:
385 tcaatacaaggaggataattctcaaaaatatggggacaagaccaagaacag 435  Q
    ||||||||||||||| || |||||||||||||| ||| || ||||||||||    
49525056 tcaatacaaggaggacaaatctcaaaaatatggtgactagtccaagaacag 49525106  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 150702 times since January 2019
Visitors: 1522