View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0095_low_22 (Length: 453)

Name: NF0095_low_22
Description: NF0095
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0095_low_22
NF0095_low_22
[»] chr7 (1 HSPs)
chr7 (28-424)||(34844661-34845057)
[»] chr2 (2 HSPs)
chr2 (320-381)||(21776953-21777014)
chr2 (233-287)||(21776849-21776903)


Alignment Details
Target: chr7 (Bit Score: 377; Significance: 0; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 377; E-Value: 0
Query Start/End: Original strand, 28 - 424
Target Start/End: Complemental strand, 34845057 - 34844661
Alignment:
28 cactaattaacttaatcttttctcataagcaacttgttgatgttgaagatgatgaagagtgaaaattaagaattgacaaaactcgtatataaattatttc 127  Q
    ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34845057 cactaattaacttaatcttttatcataagcaacttgttgatgttgaagatgatgaagagtgaaaattaagaattgacaaaactcgtatataaattatttc 34844958  T
128 attgattgtaatagagaagagaaactgccttctaagtttaatatatagaacaacattgaagttgactaaaaaacactgaaaacaataagggaattaacta 227  Q
    ||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34844957 attgattgtgatagagaagagaaactgccttctaagttttatatatagaacaacattgaagttgactaaaaaacactgaaaacaataagggaattaacta 34844858  T
228 ttaagtaaggaagaagaacaccatagacaacacttacttgcaacacaagctatcaaagcttaagcaagttaataaactacttcccatatttgtaggaaag 327  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34844857 ttaattaaggaagaagaacaccatagacaacacttacttgcaacacaagctatcaaagcttaagcaagttaataaactacttcccatatttgtaggaaag 34844758  T
328 tcagttatcatcctatgagattgagttcatagtagtttatcatgttctctcatagaaccacgataaataaatgtaatagcttcattcacaagttaat 424  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||    
34844757 tcagttatcatcctatgagattgagttcatagtagtttatcatgttctctcatagaaccacaataaataaatgtaatagcttcattcacaagttaat 34844661  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 38; Significance: 0.000000000003; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 320 - 381
Target Start/End: Original strand, 21776953 - 21777014
Alignment:
320 taggaaagtcagttatcatcctatgagattgagttcatagtagtttatcatgttctctcata 381  Q
    ||||||||| ||||||||||||||||||| |||||| |||||| |||||||  |||||||||    
21776953 taggaaagttagttatcatcctatgagatagagttcttagtagcttatcatactctctcata 21777014  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 233 - 287
Target Start/End: Original strand, 21776849 - 21776903
Alignment:
233 taaggaagaagaacaccatagacaacacttacttgcaacacaagctatcaaagct 287  Q
    |||||||||||||||||||| |   || |||||||||||||||||||||||||||    
21776849 taaggaagaagaacaccatacatctcaattacttgcaacacaagctatcaaagct 21776903  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 126748 times since January 2019
Visitors: 1391