View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0095_low_23 (Length: 446)

Name: NF0095_low_23
Description: NF0095
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0095_low_23
NF0095_low_23
[»] chr8 (3 HSPs)
chr8 (43-439)||(28379653-28380055)
chr8 (42-368)||(28389364-28389698)
chr8 (42-159)||(28414968-28415085)


Alignment Details
Target: chr8 (Bit Score: 308; Significance: 1e-173; HSPs: 3)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 308; E-Value: 1e-173
Query Start/End: Original strand, 43 - 439
Target Start/End: Complemental strand, 28380055 - 28379653
Alignment:
43 aaccttaatgatgtattctcagaacaagcacagagcaagaaacaaaacttcataatcattcctaaccaccaaaagaagataacattattgttcttcttac 142  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
28380055 aaccttaatgatgtattctcagaacaagcacagagcaagaaacaaaacttcataatcattcctaaccaccaaaagaagataacattattgttcttcttac 28379956  T
143 tcaacatcttcatcttc------tcttaacctgcaaaagtaaaaatatgaagctgcatttcatcagaaacatagttcaaggctaaaatagaagaaaataa 236  Q
    |||||||||||||||||      ||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||    
28379955 tcaacatcttcatcttcatcttctcttaacctacaaaagtaaaaatttgaagctgcatttcatcagaaacatagttcaaggctaaaatagaagaaaataa 28379856  T
237 ttaaaaaatttaatgctattaaactaccataccatatataaatgtaatgataattaaaagaatttcaacaagaaaggaaataagacatggacgaacctta 336  Q
    |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
28379855 ttaaaaaaattaatgctattaaactaccataccatatataaatgtaatgataattaaaagaatttcaacaagaaaggaaataagacatggacgaacctta 28379756  T
337 gaatatactaaatgtattaattttcttcatggnnnnnnnnnnnnnccatagaagatgaaagaataaaagaccaagtgagannnnnnngttttctcctatg 436  Q
    ||||||||||||||||||||||||||||||||             |||||||||||||||||||||||||||||||||||       |||||||||||||    
28379755 gaatatactaaatgtattaattttcttcatggaaaaaacaaaaaaccatagaagatgaaagaataaaagaccaagtgagatttttttgttttctcctatg 28379656  T
437 ata 439  Q
    |||    
28379655 ata 28379653  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 165; E-Value: 4e-88
Query Start/End: Original strand, 42 - 368
Target Start/End: Complemental strand, 28389698 - 28389364
Alignment:
42 gaaccttaatgatgtattctcagaacaagcacagagcaagaaacaaaacttcataatcattcctaaccaccaaaagaagataacattattgttcttctta 141  Q
    |||||| |||||||| ||||||| |||| |||| | ||||||||| || | || ||||||||| ||||||||| | ||||||||||  ||||||||||||    
28389698 gaacctcaatgatgtcttctcagcacaaacacataacaagaaacagaattgcacaatcattccaaaccaccaatataagataacatgtttgttcttctta 28389599  T
142 ctcaacatcttcatcttc------tcttaacctgcaaaagtaaaaatatgaagctgcatttcatcagaaacatagttcaaggctaaaatagaagaaaata 235  Q
    |||||||  |||||||||      ||||||||| ||||||||||||| |||||||||||||||| ||||||||| ||||||||||||| || ||||| ||    
28389598 ctcaacactttcatcttcatcatttcttaacctacaaaagtaaaaatttgaagctgcatttcataagaaacatatttcaaggctaaaaaagtagaaatta 28389499  T
236 attaaaaaatttaatgctattaaactaccataccatatataaatgtaatgataattaaaagaatttcaacaagaaaggaaat-----aagacatggacga 330  Q
    ||||||||| |||||||||||||||||| ||||||||||||||| | ||||||||||||||||||||||||||||| |||||     |||||||||||||    
28389498 attaaaaaaattaatgctattaaactactataccatatataaatatgatgataattaaaagaatttcaacaagaaaagaaatttttaaagacatggacga 28389399  T
331 accttagaatatactaaatgtattaattttcttcatgg 368  Q
    |||||||||||   ||||||||||||||||||||||||    
28389398 accttagaata---taaatgtattaattttcttcatgg 28389364  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 86; E-Value: 6e-41
Query Start/End: Original strand, 42 - 159
Target Start/End: Original strand, 28414968 - 28415085
Alignment:
42 gaaccttaatgatgtattctcagaacaagcacagagcaagaaacaaaacttcataatcattcctaaccaccaaaagaagataacattattgttcttctta 141  Q
    |||||||||||||||||||| |||||||||||| ||||||||||| ||||||| ||||||||| ||||||||||||||||||||||||||||||||| ||    
28414968 gaaccttaatgatgtattctgagaacaagcacatagcaagaaacagaacttcacaatcattccaaaccaccaaaagaagataacattattgttcttcata 28415067  T
142 ctcaacatcttcatcttc 159  Q
    |||||||  |||||||||    
28415068 ctcaacacgttcatcttc 28415085  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 126670 times since January 2019
Visitors: 1391