View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0095_low_24 (Length: 445)

Name: NF0095_low_24
Description: NF0095
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0095_low_24
NF0095_low_24
[»] chr2 (1 HSPs)
chr2 (8-397)||(19082389-19082771)


Alignment Details
Target: chr2 (Bit Score: 270; Significance: 1e-151; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 270; E-Value: 1e-151
Query Start/End: Original strand, 8 - 397
Target Start/End: Original strand, 19082389 - 19082771
Alignment:
8 aattggcatagttacacttaaagcaagatttttatgtttctagtttttcaagctttatgatttttctctgcaaataagtttgtggcttattttttatgac 107  Q
    |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
19082389 aattggcatagttacacttaaagcaagattttaatgtttctagtttttcaagctttatgatttttctctgcaaataagtttgtggcttattttttatgac 19082488  T
108 ctgtaannnnnnngaataatacgttgaatcacgatgacattacattattaatttaccacataatcaaatataattccacannnnnnnnnatttctttctn 207  Q
     |||||       ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||           ||| |||||     
19082489 gtgtaaattttttgaataatacgttgaatcacgatgacattacattattaatttaccacataatcaaatataattccacttt--------tttttttcta 19082580  T
208 nnnnnntaatataactccacatcatcaattaattaatatggcatgtcataaaa-aatcgtttgaaaacgagttgtgtgaaagaaattttaaacttgtaaa 306  Q
          |||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||| |||||||    
19082581 aaaaaataatataattccacatcatcaattaattaatatggcatgtcataaaaaaatcgtttgaaaacgagttgtgcgaaagaaattttaaaattgtaaa 19082680  T
307 acatagactaaaattttagagaaacaaatccatggactaaaatctttttgagattaaaaatttgaaccatgtcaaattcttgttttctgat 397  Q
    |||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
19082681 acatagactaaaattttagataaacaaatgcatggactaaaatctttttgagattaaaaatttgaaccatgtcaaattcttgttttctgat 19082771  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 126617 times since January 2019
Visitors: 1391