View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0095_low_26 (Length: 441)

Name: NF0095_low_26
Description: NF0095
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0095_low_26
NF0095_low_26
[»] chr7 (1 HSPs)
chr7 (29-431)||(30450276-30450678)


Alignment Details
Target: chr7 (Bit Score: 383; Significance: 0; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 383; E-Value: 0
Query Start/End: Original strand, 29 - 431
Target Start/End: Original strand, 30450276 - 30450678
Alignment:
29 aagtcctgtgagggtcaatcaaaatgaggtaattgcattcaactcccttggaaattgaaggtaggttggtgcaattttcccgacaaatgagggtaatgag 128  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||    
30450276 aagtcctgtgagggtcaatcaaaatgaggtaattgcattcaactccctttgaaattgaaggtaggttggtgcaattttcccgacaaatgagggtaatgag 30450375  T
129 cttttgtttaaaaaattaaagatgtgtacgtgttatttaagcatacctcaaggggtatgtatgagtgcaacttctccaagcaaaatcaaactttttgttg 228  Q
    |||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||    
30450376 cttttgtttaaaaaatcaaagatgtgtacgtgttatttaagcatacctcatggggtatgtatgagtgcaacttctccaagcaaaatcaaactttttgttg 30450475  T
229 ttgaaaaggacagcttttgttactactattattgaaggatgtgctttactgcttttactaaaaacttcttacttatcagttctttatgtactgtggttag 328  Q
    ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
30450476 ttgaaaaagacagcttttgttactactattattgaaggatgtgctttactgcttttactaaaaacttcttacttatcagttctttatgtactgtggttag 30450575  T
329 tgggaccaaagcctttagctttttattcatacacttgcattcctatgttgccttttatttacaggatgcccagaaagaatgtcttcttgttaacgcccct 428  Q
    |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
30450576 tgggaccaaagcctttagctttttattcatacacatgcattcctatgttgccttttatttacaggatgcccagaaagaatgtcttcttgttaacgcccct 30450675  T
429 ttg 431  Q
    |||    
30450676 ttg 30450678  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 150928 times since January 2019
Visitors: 1524