View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0095_low_28 (Length: 420)

Name: NF0095_low_28
Description: NF0095
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0095_low_28
NF0095_low_28
[»] chr2 (1 HSPs)
chr2 (13-391)||(15783552-15783933)
[»] chr5 (3 HSPs)
chr5 (63-272)||(19970455-19970664)
chr5 (86-257)||(1348708-1348879)
chr5 (178-272)||(20110844-20110938)


Alignment Details
Target: chr2 (Bit Score: 327; Significance: 0; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 327; E-Value: 0
Query Start/End: Original strand, 13 - 391
Target Start/End: Complemental strand, 15783933 - 15783552
Alignment:
13 cagaggattgaacaacacgtgagtttaaaagatttgagggtacggtcctgagagcgtggggaaaacataacggcatccaacatttgacgaaactgaatca 112  Q
    |||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||    
15783933 cagaggattgaacaacacgtgagtttaaaagatttgtgggtactgtcctgagagcgtggggaaaacataacggcatccaacatttgacggaactgaatca 15783834  T
113 agtccttttcatttttcacgccatcatcgttgatgtggagaacggggagtgagtggcacaattgaacccatctctttgaaagaagggttgtcctgaaagc 212  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||    
15783833 agtccttttcatttttcacgccatcatcgttgatgtggagaacggggagtgagcggcacaatagaacccatctctttgaaagaagggttgtcctgaaagc 15783734  T
213 atctttgatcggtagaaaagagattatatgagttagtatatcgtcgtggaaatcgttgatggtgttggtagtattcttcctcttactgttattttcgttt 312  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||    
15783733 atctttgatcggtagaaaagagattatatgagttagtatatcgtcgtggaaatcgttgatggtgttggtagtattcttcctcttactattattttcgttt 15783634  T
313 tccatgaatggcttctgtgtagaacaatgtatatctcttggttaaagttaatt--aacacaaaattttggcct-gttttaac 391  Q
    ||||||||||||||||||||||||||||||||||||||||||| |||||||||  ||| |||||||||| ||| ||||||||    
15783633 tccatgaatggcttctgtgtagaacaatgtatatctcttggttcaagttaattcgaacccaaaattttgccctagttttaac 15783552  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 58; Significance: 3e-24; HSPs: 3)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 63 - 272
Target Start/End: Original strand, 19970455 - 19970664
Alignment:
63 agagcgtggggaaaacataacggcatccaacatttgacgaaactgaatcaagtccttttcatttttcacgccatcatcgttgatgtggagaacggggagt 162  Q
    |||||||||||| ||||||||||||| |||||||||| | |||||||||   |||||| |||| |||||| | | || || || ||||||||  ||||||    
19970455 agagcgtggggagaacataacggcattcaacatttgatggaactgaatctgttcctttacattgttcacgtctttattgtcgaagtggagaatcgggagt 19970554  T
163 gagtggcacaattgaacccatctctttgaaagaagggttgtcctgaaagcatctttgatcggtagaaaagagattatatgagttagtatatcgtcgtgga 262  Q
    |||| |||||||   |||||  |||| ||||| | ||| || |||||||| ||| |||| || ||||||||||  || |||||||||||||||||  |||    
19970555 gagtagcacaatgagacccacgtcttggaaagcacggtggttctgaaagcgtctctgattggaagaaaagagagaatgtgagttagtatatcgtctggga 19970654  T
263 aatcgttgat 272  Q
    | ||||||||    
19970655 agtcgttgat 19970664  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 86 - 257
Target Start/End: Original strand, 1348708 - 1348879
Alignment:
86 catccaacatttgacgaaactgaatcaagtccttttcatttttcacgccatcatcgttgatgtggagaacggggagtgagtggcacaattgaacccatct 185  Q
    ||||||||||||||||||| |||||| | |||||| | ||||||||  | |  |||| ||||||| |||  || |||| |||| | ||| | | ||||||    
1348708 catccaacatttgacgaaagtgaatccaatcctttccgtttttcacttctttgtcgtcgatgtggggaatcggaagtgtgtggaataatgggaaccatct 1348807  T
186 ctttgaaagaagggttgtcctgaaagcatctttgatcggtagaaaagagattatatgagttagtatatcgtc 257  Q
    ||| ||||||| ||| || |||||||| |||||||  |  ||||||||||| || ||||||||||| |||||    
1348808 cttagaaagaatggtagttctgaaagcgtctttgaatgtgagaaaagagataatgtgagttagtatctcgtc 1348879  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 178 - 272
Target Start/End: Complemental strand, 20110938 - 20110844
Alignment:
178 acccatctctttgaaagaagggttgtcctgaaagcatctttgatcggtagaaaagagattatatgagttagtatatcgtcgtggaaatcgttgat 272  Q
    |||||| ||||||| |||| ||| ||  ||||||| |||||||  || ||||||||||  || |||||||||||||||||  |||| ||||||||    
20110938 acccatttctttgagagaacggtggttttgaaagcgtctttgaatggaagaaaagagacgatgtgagttagtatatcgtctgggaagtcgttgat 20110844  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 150714 times since January 2019
Visitors: 1522