View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0095_low_30 (Length: 406)

Name: NF0095_low_30
Description: NF0095
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0095_low_30
NF0095_low_30
[»] chr3 (1 HSPs)
chr3 (30-406)||(3932766-3933142)


Alignment Details
Target: chr3 (Bit Score: 369; Significance: 0; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 369; E-Value: 0
Query Start/End: Original strand, 30 - 406
Target Start/End: Complemental strand, 3933142 - 3932766
Alignment:
30 gtaatatcctcccatccatattttggagaagatactgaagctttcactctgacccaatctccaacctgatttcagatatattaacaatttaaatacagga 129  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3933142 gtaatatcctcccatccatattttggagaagatactgaagctttcactctgacccaatctccaacctgatttcagatatattaacaatttaaatacagga 3933043  T
130 aaacaataataaggcattacccagtaagtacaaggtaacaaacttaaaatggaagcaaatgatcaacatcaaccaaaagaattgtcaccttaaaatcttc 229  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3933042 aaacaataataaggcattacgcagtaagtacaaggtaacaaacttaaaatggaagcaaatgatcaacatcaaccaaaagaattgtcaccttaaaatcttc 3932943  T
230 caccttctccatatcagatggatcagcttgccatggtatgggtcgatttggtatttctattattaagagaccatcattctcaatctcacttattcttcca 329  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3932942 caccttctccatatcagatggatcagcttgccatggtatgggtcgatttggtatttctattattaagagaccatcattctcaatctcacttattcttcca 3932843  T
330 acactgtgatgtgtctcaccaccccaagcatatctaggttctgcaacagatcgcttcacacataccctatcaccaat 406  Q
    |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||    
3932842 acactgtgatgtgtctcaccaccccaagcatatctaggttctgcgacagatcgcttcacacataccctatcaccaat 3932766  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 126397 times since January 2019
Visitors: 1390