View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0095_low_31 (Length: 377)

Name: NF0095_low_31
Description: NF0095
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0095_low_31
NF0095_low_31
[»] chr2 (1 HSPs)
chr2 (1-348)||(2922888-2923235)
[»] chr4 (1 HSPs)
chr4 (13-261)||(36127917-36128165)


Alignment Details
Target: chr2 (Bit Score: 344; Significance: 0; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 344; E-Value: 0
Query Start/End: Original strand, 1 - 348
Target Start/End: Original strand, 2922888 - 2923235
Alignment:
1 ttcatctgagaatccactttggaaagtgctgttttgagttcttcgatattcagtttaattgattctttttcaacatctcccttggcttccttcaataaat 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2922888 ttcatctgagaatccactttggaaagtgctgttttgagttcttcgatattcagtttaattgattctttttcaacatctcccttggcttccttcaataaat 2922987  T
101 cagcaatgttgtgcatctgtttatttttcagatacagctcaacctgaggatatcgtacacagatgtcatccatgacctcttgaaattctttgaccgtaag 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2922988 cagcaatgttgtgcatctgtttatttttcagatacagctcaacctgaggatatcgtacacagatgtcatccatgacctcttgaaattctttgaccgtaag 2923087  T
201 tgttcctgaattgcctttgtcggccttcttaaagatcgaagcaatatcttcctgaaatgccaaagtcaatccaataacagtaaaaaagagtacatttgaa 300  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2923088 tgttcctgaattgcctttgtcggccttcttaaagatcgaagcaatatcttcctgaaatgccaaagtcaatccaataacagtaaaaaagagtacatttgaa 2923187  T
301 ttgaaatactggacagataatatctcataggttaattggtaatcaaac 348  Q
    ||||||||||||||||||||||||||||||||||||||||| ||||||    
2923188 ttgaaatactggacagataatatctcataggttaattggtactcaaac 2923235  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 93; Significance: 3e-45; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 93; E-Value: 3e-45
Query Start/End: Original strand, 13 - 261
Target Start/End: Complemental strand, 36128165 - 36127917
Alignment:
13 tccactttggaaagtgctgttttgagttcttcgatattcagtttaattgattctttttcaacatctcccttggcttccttcaataaatcagcaatgttgt 112  Q
    ||||| |||||||  || || ||||||||||||||||| |||| ||| |||||||||| |||||||||||||| ||||||||| | ||||||||||   |    
36128165 tccacattggaaaaagcggtcttgagttcttcgatattgagttcaatagattcttttttaacatctcccttggattccttcaacagatcagcaatgccat 36128066  T
113 gcatctgtttatttttcagatacagctcaacctgaggatatcgtacacagatgtcatccatgacctcttgaaattctttgaccgtaagtgttcctgaatt 212  Q
    ||||||||||||| || ||||| ||||| |||||||| || | | |||||||||||| ||| ||||| |||||||||||||  |||||||||||||| ||    
36128065 gcatctgtttattctttagatatagctccacctgagggtacctttcacagatgtcattcattacctcctgaaattctttgagtgtaagtgttcctgagtt 36127966  T
213 gcctttgtcggccttcttaaagatcgaagcaatatcttcctgaaatgcc 261  Q
    | ||   || | ||||||||| ||||  ||||||||||||| |||||||    
36127965 gtctgcatcagtcttcttaaatatcgccgcaatatcttcctaaaatgcc 36127917  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 150732 times since January 2019
Visitors: 1522