View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0095_low_33 (Length: 371)

Name: NF0095_low_33
Description: NF0095
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0095_low_33
NF0095_low_33
[»] chr2 (1 HSPs)
chr2 (13-342)||(15783552-15783884)
[»] chr5 (3 HSPs)
chr5 (14-223)||(19970455-19970664)
chr5 (37-208)||(1348708-1348879)
chr5 (129-223)||(20110844-20110938)


Alignment Details
Target: chr2 (Bit Score: 282; Significance: 1e-158; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 282; E-Value: 1e-158
Query Start/End: Original strand, 13 - 342
Target Start/End: Complemental strand, 15783884 - 15783552
Alignment:
13 gagagcgtggggaaaacataatggcatccaacatttgacgaaactgaatcaagtccttttcatttttcacgccatcatcgttgatgtggagaacggggag 112  Q
    ||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
15783884 gagagcgtggggaaaacataacggcatccaacatttgacggaactgaatcaagtccttttcatttttcacgccatcatcgttgatgtggagaacggggag 15783785  T
113 tgagtggcacaattgaacccatctctttgaaagaagggttgtcctgaaagcatctttgatcggtagaaaagagattatatgagttagtatatcgtcgtgg 212  Q
    |||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
15783784 tgagcggcacaatagaacccatctctttgaaagaagggttgtcctgaaagcatctttgatcggtagaaaagagattatatgagttagtatatcgtcgtgg 15783685  T
213 aaatcgttgatggtgttggtagtattcttcctcttactgttattttcgttttccatgaatggcttctgtgtagaacaatgtatatctcttggttaaagtt 312  Q
    |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||    
15783684 aaatcgttgatggtgttggtagtattcttcctcttactattattttcgttttccatgaatggcttctgtgtagaacaatgtatatctcttggttcaagtt 15783585  T
313 aatt--aacacaaaattttggcct-gttttaac 342  Q
    ||||  ||| |||||||||| ||| ||||||||    
15783584 aattcgaacccaaaattttgccctagttttaac 15783552  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 54; Significance: 6e-22; HSPs: 3)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 14 - 223
Target Start/End: Original strand, 19970455 - 19970664
Alignment:
14 agagcgtggggaaaacataatggcatccaacatttgacgaaactgaatcaagtccttttcatttttcacgccatcatcgttgatgtggagaacggggagt 113  Q
    |||||||||||| ||||||| ||||| |||||||||| | |||||||||   |||||| |||| |||||| | | || || || ||||||||  ||||||    
19970455 agagcgtggggagaacataacggcattcaacatttgatggaactgaatctgttcctttacattgttcacgtctttattgtcgaagtggagaatcgggagt 19970554  T
114 gagtggcacaattgaacccatctctttgaaagaagggttgtcctgaaagcatctttgatcggtagaaaagagattatatgagttagtatatcgtcgtgga 213  Q
    |||| |||||||   |||||  |||| ||||| | ||| || |||||||| ||| |||| || ||||||||||  || |||||||||||||||||  |||    
19970555 gagtagcacaatgagacccacgtcttggaaagcacggtggttctgaaagcgtctctgattggaagaaaagagagaatgtgagttagtatatcgtctggga 19970654  T
214 aatcgttgat 223  Q
    | ||||||||    
19970655 agtcgttgat 19970664  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 37 - 208
Target Start/End: Original strand, 1348708 - 1348879
Alignment:
37 catccaacatttgacgaaactgaatcaagtccttttcatttttcacgccatcatcgttgatgtggagaacggggagtgagtggcacaattgaacccatct 136  Q
    ||||||||||||||||||| |||||| | |||||| | ||||||||  | |  |||| ||||||| |||  || |||| |||| | ||| | | ||||||    
1348708 catccaacatttgacgaaagtgaatccaatcctttccgtttttcacttctttgtcgtcgatgtggggaatcggaagtgtgtggaataatgggaaccatct 1348807  T
137 ctttgaaagaagggttgtcctgaaagcatctttgatcggtagaaaagagattatatgagttagtatatcgtc 208  Q
    ||| ||||||| ||| || |||||||| |||||||  |  ||||||||||| || ||||||||||| |||||    
1348808 cttagaaagaatggtagttctgaaagcgtctttgaatgtgagaaaagagataatgtgagttagtatctcgtc 1348879  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 129 - 223
Target Start/End: Complemental strand, 20110938 - 20110844
Alignment:
129 acccatctctttgaaagaagggttgtcctgaaagcatctttgatcggtagaaaagagattatatgagttagtatatcgtcgtggaaatcgttgat 223  Q
    |||||| ||||||| |||| ||| ||  ||||||| |||||||  || ||||||||||  || |||||||||||||||||  |||| ||||||||    
20110938 acccatttctttgagagaacggtggttttgaaagcgtctttgaatggaagaaaagagacgatgtgagttagtatatcgtctgggaagtcgttgat 20110844  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 148934 times since January 2019
Visitors: 1515