View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0095_low_34 (Length: 370)

Name: NF0095_low_34
Description: NF0095
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF0095_low_34
[»] chr5 (1 HSPs)
chr5 (43-370)||(19755198-19755525)
[»] chr3 (1 HSPs)
chr3 (81-181)||(8135128-8135228)

Alignment Details
Target: chr5 (Bit Score: 276; Significance: 1e-154; HSPs: 1)
Name: chr5

Target: chr5; HSP #1
Raw Score: 276; E-Value: 1e-154
Query Start/End: Original strand, 43 - 370
Target Start/End: Original strand, 19755198 - 19755525
43 catcatcagagttcaacccacgaggttctttactttttccaccttcgaccggagatggacccccttcattttcttcataaatgtgttgttgatcatcttc 142  Q
    |||| ||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||    
19755198 catcttcagagttcaacccacgaggttctttactttttccactttcgaccagagatggacccccttcattttcttcatcaatgtgttgttgatcatcttc 19755297  T
143 aacacttttagcattcaaatcttgaggaggttcagaaagcattttctctcggtcttcatcatctttgggaggactagagtcaactatcatattgtcctca 242  Q
    |||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||    
19755298 aacacttttatcattcaaatcttgaggaggttcagaaagcattttctctgggtcttcatcatctttgggaggactagagtcaattatcatattgtcctca 19755397  T
243 aagatggggtcaattgactggttaaaagtggaaggaggtgtttgttgcttgcccgtttcggcattgctaactttagcacccttaaacacataaaaaagtc 342  Q
    |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||| ||||||||    
19755398 aagatggggttaattgactggttaaaagtggaaggaggtgtttgttgcttgcccgtttcggcattgctaacttcagcaccctgaaacacattaaaaagtc 19755497  T
343 gaagtaaataaagaaggcttgttaaaga 370  Q
    ||||| ||||||||||| ||||||||||    
19755498 gaagttaataaagaaggtttgttaaaga 19755525  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr3

Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 81 - 181
Target Start/End: Complemental strand, 8135228 - 8135128
81 ccaccttcgaccggagatggacccccttcattttcttcataaatgtgttgttgatcatcttcaacacttttagcattcaaatcttgaggaggttcagaaa 180  Q
    |||| ||||||  |||||||||||||||| | ||| |||| | |||| || ||||||||||||| |||| | |||||  ||||||||| | | |||||||    
8135228 ccactttcgactagagatggacccccttcgtcttcctcatcagtgtgatgctgatcatcttcaatacttctggcatttgaatcttgagaatgatcagaaa 8135129  T
181 g 181  Q
8135128 g 8135128  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 151261 times since January 2019
Visitors: 1526