View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0095_low_36 (Length: 370)

Name: NF0095_low_36
Description: NF0095
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0095_low_36
NF0095_low_36
[»] scaffold0234 (2 HSPs)
scaffold0234 (23-344)||(2041-2362)
scaffold0234 (23-344)||(10932-11253)
[»] chr6 (43 HSPs)
chr6 (23-344)||(17684189-17684510)
chr6 (23-344)||(27380972-27381293)
chr6 (23-344)||(27471355-27471676)
chr6 (23-344)||(11651889-11652210)
chr6 (23-344)||(17691160-17691481)
chr6 (23-344)||(29309056-29309377)
chr6 (23-344)||(29316016-29316336)
chr6 (23-344)||(188697-189018)
chr6 (105-344)||(27296877-27297116)
chr6 (71-344)||(16394165-16394438)
chr6 (103-340)||(25536915-25537152)
chr6 (122-343)||(16559193-16559414)
chr6 (19-327)||(13359010-13359314)
chr6 (23-127)||(16566257-16566361)
chr6 (40-334)||(2669476-2669768)
chr6 (37-344)||(16789071-16789373)
chr6 (37-344)||(22859888-22860190)
chr6 (37-344)||(27508347-27508649)
chr6 (37-344)||(1586108-1586410)
chr6 (37-330)||(27527947-27528235)
chr6 (37-344)||(14074480-14074782)
chr6 (37-300)||(18019885-18020143)
chr6 (29-322)||(10359073-10359359)
chr6 (37-344)||(8612915-8613221)
chr6 (38-166)||(27925935-27926062)
chr6 (38-241)||(17850321-17850521)
chr6 (107-259)||(20736413-20736562)
chr6 (55-160)||(28172754-28172859)
chr6 (29-161)||(20553492-20553622)
chr6 (90-275)||(8510155-8510338)
chr6 (231-344)||(33317055-33317167)
chr6 (105-344)||(17120505-17120740)
chr6 (23-75)||(25537148-25537200)
chr6 (37-132)||(13995151-13995245)
chr6 (105-247)||(21994655-21994794)
chr6 (35-247)||(19218427-19218630)
chr6 (51-172)||(19347092-19347212)
chr6 (36-216)||(22560311-22560487)
chr6 (203-266)||(28172899-28172963)
chr6 (188-327)||(28756145-28756283)
chr6 (112-259)||(5758565-5758709)
chr6 (35-247)||(4073574-4073781)
chr6 (37-73)||(20736594-20736630)
[»] chr4 (57 HSPs)
chr4 (23-344)||(18262378-18262699)
chr4 (23-344)||(18269239-18269560)
chr4 (23-344)||(55612849-55613170)
chr4 (23-344)||(26963806-26964127)
chr4 (23-344)||(26970629-26970950)
chr4 (23-344)||(868763-869084)
chr4 (23-344)||(19926480-19926801)
chr4 (23-344)||(5707486-5707807)
chr4 (23-344)||(5714114-5714435)
chr4 (23-344)||(8858333-8858654)
chr4 (23-344)||(10621053-10621374)
chr4 (29-344)||(10628132-10628447)
chr4 (23-344)||(28392854-28393175)
chr4 (23-344)||(8845369-8845690)
chr4 (23-344)||(4426336-4426645)
chr4 (29-344)||(35223732-35224047)
chr4 (33-344)||(5667849-5668156)
chr4 (23-348)||(20311458-20311781)
chr4 (112-344)||(10677303-10677534)
chr4 (112-344)||(10890943-10891174)
chr4 (37-344)||(15461497-15461799)
chr4 (37-344)||(34975551-34975853)
chr4 (37-344)||(2677013-2677315)
chr4 (37-344)||(15815021-15815323)
chr4 (37-344)||(18111043-18111345)
chr4 (37-344)||(3369023-3369325)
chr4 (37-344)||(17299959-17300261)
chr4 (37-344)||(18163162-18163464)
chr4 (37-344)||(20243937-20244239)
chr4 (37-344)||(26531613-26531915)
chr4 (37-344)||(4675983-4676285)
chr4 (33-169)||(56516232-56516368)
chr4 (38-344)||(5870419-5870720)
chr4 (93-243)||(21453961-21454110)
chr4 (37-328)||(19365519-19365806)
chr4 (37-344)||(1941724-1942026)
chr4 (58-344)||(32646523-32646807)
chr4 (105-327)||(19362477-19362695)
chr4 (112-344)||(9487625-9487853)
chr4 (37-242)||(32636484-32636685)
chr4 (105-328)||(5528495-5528714)
chr4 (29-328)||(5616387-5616681)
chr4 (41-119)||(24700213-24700291)
chr4 (124-344)||(30040489-30040705)
chr4 (112-328)||(9538033-9538244)
chr4 (37-259)||(4546080-4546298)
chr4 (127-344)||(11421096-11421309)
chr4 (216-266)||(24701361-24701411)
chr4 (93-247)||(33888594-33888743)
chr4 (29-81)||(10677538-10677590)
chr4 (29-81)||(10891178-10891230)
chr4 (84-211)||(34777850-34777975)
chr4 (25-95)||(9937933-9938003)
chr4 (235-316)||(9937745-9937826)
chr4 (114-205)||(9937830-9937923)
chr4 (37-73)||(11421016-11421052)
chr4 (29-73)||(30040740-30040784)
[»] chr3 (46 HSPs)
chr3 (23-344)||(6110230-6110551)
chr3 (23-344)||(16482203-16482524)
chr3 (23-344)||(10579075-10579396)
chr3 (23-344)||(15600604-15600925)
chr3 (23-344)||(15607149-15607470)
chr3 (23-344)||(10572312-10572633)
chr3 (23-344)||(15341939-15342260)
chr3 (23-344)||(18520141-18520462)
chr3 (38-344)||(8490676-8490982)
chr3 (30-340)||(18522836-18523146)
chr3 (23-344)||(15357306-15357627)
chr3 (23-344)||(17780838-17781159)
chr3 (23-344)||(13211468-13211789)
chr3 (29-344)||(13248779-13249094)
chr3 (23-344)||(32056619-32056941)
chr3 (23-348)||(17199900-17200225)
chr3 (23-344)||(13516977-13517294)
chr3 (29-344)||(1647241-1647556)
chr3 (23-344)||(17136525-17136840)
chr3 (23-344)||(29925137-29925458)
chr3 (23-344)||(29974290-29974611)
chr3 (54-344)||(16200627-16200917)
chr3 (37-344)||(21034238-21034540)
chr3 (37-344)||(15846536-15846838)
chr3 (37-344)||(20147554-20147856)
chr3 (37-344)||(21398792-21399094)
chr3 (29-326)||(24253130-24253423)
chr3 (37-344)||(14890391-14890693)
chr3 (37-344)||(55427021-55427323)
chr3 (37-344)||(12299911-12300212)
chr3 (105-344)||(25978728-25978963)
chr3 (29-246)||(14147013-14147226)
chr3 (112-310)||(15526827-15527021)
chr3 (186-344)||(28088251-28088408)
chr3 (105-344)||(11787654-11787889)
chr3 (40-344)||(15317176-15317472)
chr3 (76-205)||(28953965-28954093)
chr3 (23-75)||(19089734-19089786)
chr3 (78-270)||(32280313-32280507)
chr3 (29-122)||(9504455-9504548)
chr3 (33-148)||(8251933-8252048)
chr3 (191-306)||(30464147-30464261)
chr3 (23-96)||(16200291-16200363)
chr3 (183-247)||(36138033-36138097)
chr3 (116-168)||(4189223-4189275)
chr3 (183-247)||(36142816-36142880)
[»] chr1 (38 HSPs)
chr1 (23-344)||(18252196-18252517)
chr1 (23-344)||(18532234-18532555)
chr1 (23-344)||(27131130-27131450)
chr1 (23-344)||(27310297-27310618)
chr1 (23-344)||(16358755-16359076)
chr1 (29-344)||(3855639-3855954)
chr1 (29-344)||(36816354-36816668)
chr1 (63-344)||(22641594-22641871)
chr1 (29-344)||(27277278-27277592)
chr1 (23-216)||(21171081-21171274)
chr1 (37-344)||(19706439-19706741)
chr1 (37-344)||(43802365-43802667)
chr1 (37-344)||(28134723-28135025)
chr1 (23-177)||(22657108-22657262)
chr1 (53-344)||(23507096-23507385)
chr1 (37-344)||(9456116-9456418)
chr1 (151-344)||(9916497-9916689)
chr1 (29-266)||(12014084-12014319)
chr1 (37-344)||(20391239-20391541)
chr1 (37-344)||(20779645-20779947)
chr1 (37-344)||(22670257-22670559)
chr1 (37-344)||(42816989-42817291)
chr1 (37-344)||(22612492-22612794)
chr1 (28-324)||(633925-634216)
chr1 (30-146)||(9917837-9917952)
chr1 (37-344)||(8727667-8727969)
chr1 (37-344)||(47667485-47667776)
chr1 (105-328)||(29096789-29097008)
chr1 (37-169)||(35930582-35930713)
chr1 (53-142)||(12006461-12006550)
chr1 (231-344)||(28145723-28145835)
chr1 (112-244)||(21881475-21881604)
chr1 (92-257)||(24301691-24301855)
chr1 (45-171)||(26923553-26923678)
chr1 (112-165)||(51997353-51997406)
chr1 (197-277)||(12006332-12006413)
chr1 (183-242)||(10852402-10852461)
chr1 (126-205)||(31236402-31236478)
[»] chr8 (42 HSPs)
chr8 (23-343)||(21940831-21941151)
chr8 (23-344)||(22171653-22171974)
chr8 (23-344)||(6094289-6094610)
chr8 (23-344)||(24642815-24643135)
chr8 (81-344)||(15326422-15326685)
chr8 (81-344)||(15506791-15507054)
chr8 (203-344)||(28548393-28548534)
chr8 (34-277)||(14983710-14983950)
chr8 (29-344)||(8371253-8371563)
chr8 (37-344)||(21969333-21969635)
chr8 (32-229)||(24797224-24797419)
chr8 (37-344)||(12562123-12562425)
chr8 (37-344)||(27007517-27007819)
chr8 (37-344)||(27014660-27014962)
chr8 (37-344)||(27880487-27880789)
chr8 (37-344)||(28020668-28020970)
chr8 (29-328)||(38232115-38232412)
chr8 (37-344)||(22130609-22130911)
chr8 (37-344)||(25611195-25611497)
chr8 (38-344)||(22659494-22659795)
chr8 (37-344)||(21916676-21916978)
chr8 (37-344)||(45534273-45534575)
chr8 (37-344)||(26240484-26240786)
chr8 (29-247)||(18835342-18835556)
chr8 (25-164)||(32872741-32872880)
chr8 (105-344)||(6430953-6431188)
chr8 (113-259)||(8781959-8782102)
chr8 (60-146)||(2375214-2375300)
chr8 (237-334)||(24796731-24796826)
chr8 (182-328)||(20535226-20535371)
chr8 (105-344)||(2962932-2963171)
chr8 (40-134)||(29645537-29645631)
chr8 (231-349)||(36970439-36970556)
chr8 (231-348)||(2375411-2375528)
chr8 (37-144)||(36970265-36970371)
chr8 (195-317)||(29645675-29645797)
chr8 (84-136)||(10920427-10920479)
chr8 (56-111)||(24535514-24535569)
chr8 (23-58)||(28555049-28555084)
chr8 (283-344)||(8968015-8968076)
chr8 (284-332)||(41368106-41368154)
chr8 (284-332)||(41375077-41375125)
[»] chr5 (35 HSPs)
chr5 (29-344)||(24695186-24695501)
chr5 (23-344)||(19714218-19714539)
chr5 (23-344)||(19706939-19707259)
chr5 (23-344)||(18569581-18569904)
chr5 (23-222)||(39538754-39538953)
chr5 (53-344)||(17298621-17298912)
chr5 (53-344)||(17285470-17285759)
chr5 (29-257)||(18806843-18807069)
chr5 (182-348)||(27347252-27347417)
chr5 (237-344)||(24701950-24702057)
chr5 (37-344)||(20941027-20941329)
chr5 (37-344)||(25805385-25805687)
chr5 (37-344)||(31899-32201)
chr5 (37-344)||(12789663-12789965)
chr5 (37-344)||(22941250-22941552)
chr5 (37-344)||(23545922-23546224)
chr5 (34-168)||(22546912-22547046)
chr5 (37-344)||(24933306-24933608)
chr5 (39-332)||(20100255-20100543)
chr5 (37-344)||(31096816-31097118)
chr5 (37-344)||(12764990-12765296)
chr5 (37-344)||(5097651-5097953)
chr5 (37-344)||(7865430-7865736)
chr5 (37-344)||(9811733-9812039)
chr5 (37-344)||(12703874-12704180)
chr5 (119-257)||(18806483-18806619)
chr5 (119-257)||(18806663-18806799)
chr5 (29-117)||(27347425-27347513)
chr5 (259-348)||(28719471-28719558)
chr5 (95-344)||(18829281-18829530)
chr5 (37-344)||(26245102-26245404)
chr5 (105-348)||(26129689-26129928)
chr5 (263-344)||(39538954-39539035)
chr5 (40-169)||(33477193-33477321)
chr5 (38-82)||(39535465-39535509)
[»] scaffold0433 (1 HSPs)
scaffold0433 (23-344)||(7273-7594)
[»] scaffold0390 (2 HSPs)
scaffold0390 (23-344)||(6654-6975)
scaffold0390 (23-344)||(13670-13991)
[»] chr7 (49 HSPs)
chr7 (23-340)||(15152609-15152926)
chr7 (23-344)||(29327950-29328271)
chr7 (23-344)||(11535782-11536103)
chr7 (23-344)||(11542700-11543021)
chr7 (18-344)||(12750987-12751313)
chr7 (23-344)||(12738702-12739023)
chr7 (23-344)||(18561173-18561485)
chr7 (33-344)||(13392326-13392637)
chr7 (32-350)||(18257559-18257874)
chr7 (37-344)||(2204552-2204854)
chr7 (37-344)||(8464999-8465301)
chr7 (37-344)||(18400104-18400406)
chr7 (37-344)||(18407088-18407390)
chr7 (37-344)||(48808496-48808798)
chr7 (37-344)||(15729751-15730053)
chr7 (37-344)||(18139338-18139640)
chr7 (37-344)||(19230888-19231190)
chr7 (37-332)||(30254138-30254428)
chr7 (104-344)||(2365169-2365407)
chr7 (105-344)||(41680968-41681203)
chr7 (37-344)||(10668901-10669204)
chr7 (37-332)||(47166871-47167161)
chr7 (38-322)||(24443349-24443628)
chr7 (112-344)||(34128647-34128875)
chr7 (29-259)||(19388544-19388774)
chr7 (37-344)||(28130561-28130863)
chr7 (56-146)||(10235361-10235451)
chr7 (35-322)||(25845498-25845780)
chr7 (35-322)||(25845917-25846199)
chr7 (37-306)||(19393462-19393726)
chr7 (105-344)||(18259124-18259359)
chr7 (38-146)||(47833875-47833983)
chr7 (23-78)||(15148308-15148363)
chr7 (28-137)||(19859113-19859221)
chr7 (196-333)||(39112138-39112275)
chr7 (32-170)||(3132849-3132986)
chr7 (42-160)||(7662569-7662686)
chr7 (112-344)||(14591924-14592153)
chr7 (112-344)||(16011515-16011744)
chr7 (119-258)||(31190524-31190660)
chr7 (29-115)||(7396361-7396450)
chr7 (112-244)||(22969024-22969153)
chr7 (195-270)||(22948499-22948574)
chr7 (156-344)||(15169290-15169474)
chr7 (102-160)||(7396469-7396527)
chr7 (71-126)||(29983179-29983234)
chr7 (34-137)||(39111989-39112092)
chr7 (33-75)||(2365070-2365112)
chr7 (190-254)||(29984308-29984372)
[»] scaffold0220 (1 HSPs)
scaffold0220 (23-344)||(18454-18774)
[»] scaffold0186 (1 HSPs)
scaffold0186 (23-348)||(25706-26031)
[»] chr2 (28 HSPs)
chr2 (23-344)||(21329968-21330289)
chr2 (23-344)||(18796672-18796993)
chr2 (29-350)||(18619976-18620296)
chr2 (29-344)||(36270338-36270650)
chr2 (29-344)||(22183206-22183518)
chr2 (73-344)||(20978091-20978360)
chr2 (32-330)||(6991847-6992146)
chr2 (23-332)||(18822249-18822556)
chr2 (37-344)||(30174377-30174679)
chr2 (37-344)||(24250032-24250334)
chr2 (37-344)||(24229215-24229517)
chr2 (29-169)||(19279460-19279600)
chr2 (38-146)||(18851977-18852085)
chr2 (105-332)||(15342014-15342237)
chr2 (38-346)||(29800468-29800775)
chr2 (181-344)||(17241034-17241196)
chr2 (43-146)||(36801899-36802003)
chr2 (37-259)||(19616435-19616653)
chr2 (197-277)||(36799745-36799826)
chr2 (112-246)||(40301034-40301164)
chr2 (39-146)||(28741220-28741326)
chr2 (277-344)||(41661694-41661761)
chr2 (114-319)||(41316305-41316506)
chr2 (112-247)||(21626824-21626955)
chr2 (183-259)||(28740910-28740986)
chr2 (108-171)||(28718943-28719006)
chr2 (29-146)||(24763751-24763867)
chr2 (33-73)||(12098609-12098649)
[»] scaffold0657 (1 HSPs)
scaffold0657 (23-325)||(1159-1461)
[»] scaffold0063 (1 HSPs)
scaffold0063 (23-348)||(5695-6013)
[»] scaffold0008 (1 HSPs)
scaffold0008 (88-344)||(230111-230367)
[»] scaffold0112 (1 HSPs)
scaffold0112 (37-344)||(183-485)
[»] scaffold0264 (1 HSPs)
scaffold0264 (37-344)||(3675-3977)
[»] scaffold0028 (1 HSPs)
scaffold0028 (37-344)||(119730-120032)
[»] scaffold0466 (1 HSPs)
scaffold0466 (37-332)||(12961-13251)
[»] scaffold0001 (1 HSPs)
scaffold0001 (37-306)||(130262-130526)
[»] scaffold0006 (1 HSPs)
scaffold0006 (37-344)||(67374-67676)
[»] scaffold0031 (1 HSPs)
scaffold0031 (37-344)||(39988-40290)
[»] scaffold0378 (1 HSPs)
scaffold0378 (37-247)||(8305-8511)
[»] scaffold0111 (1 HSPs)
scaffold0111 (105-344)||(26609-26844)
[»] scaffold0039 (1 HSPs)
scaffold0039 (29-146)||(90033-90151)
[»] scaffold0136 (1 HSPs)
scaffold0136 (29-316)||(8723-9005)
[»] scaffold0297 (1 HSPs)
scaffold0297 (154-344)||(102-288)
[»] scaffold0376 (1 HSPs)
scaffold0376 (112-344)||(11526-11758)
[»] scaffold0034 (1 HSPs)
scaffold0034 (112-247)||(83111-83243)
[»] scaffold0086 (1 HSPs)
scaffold0086 (38-344)||(53766-54066)
[»] scaffold0118 (1 HSPs)
scaffold0118 (76-167)||(45956-46051)
[»] scaffold0393 (1 HSPs)
scaffold0393 (29-73)||(15089-15133)


Alignment Details
Target: scaffold0234 (Bit Score: 310; Significance: 1e-174; HSPs: 2)
Name: scaffold0234
Description:

Target: scaffold0234; HSP #1
Raw Score: 310; E-Value: 1e-174
Query Start/End: Original strand, 23 - 344
Target Start/End: Complemental strand, 2362 - 2041
Alignment:
23 atcatcaaagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatatta 122  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2362 atcattaaagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatatta 2263  T
123 ggagtaatatttatattggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattc 222  Q
    |||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
2262 ggagtaatatttatattggattgatccgccatgagaatactacatagtaaaagttatgaaaagtgtcataagatattctcatagtgatagtggtgtattc 2163  T
223 cacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggtt 322  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2162 cacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggtt 2063  T
323 gatgggtactccatgaatcatg 344  Q
    ||||||||||||||||||||||    
2062 gatgggtactccatgaatcatg 2041  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0234; HSP #2
Raw Score: 310; E-Value: 1e-174
Query Start/End: Original strand, 23 - 344
Target Start/End: Complemental strand, 11253 - 10932
Alignment:
23 atcatcaaagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatatta 122  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
11253 atcattaaagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatatta 11154  T
123 ggagtaatatttatattggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattc 222  Q
    |||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
11153 ggagtaatatttatattggattgatccgccatgagaatactacatagtaaaagttatgaaaagtgtcataagatattctcatagtgatagtggtgtattc 11054  T
223 cacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggtt 322  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
11053 cacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggtt 10954  T
323 gatgggtactccatgaatcatg 344  Q
    ||||||||||||||||||||||    
10953 gatgggtactccatgaatcatg 10932  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 310; Significance: 1e-174; HSPs: 43)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 310; E-Value: 1e-174
Query Start/End: Original strand, 23 - 344
Target Start/End: Complemental strand, 17684510 - 17684189
Alignment:
23 atcatcaaagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatatta 122  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
17684510 atcattaaagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatatta 17684411  T
123 ggagtaatatttatattggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattc 222  Q
    |||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
17684410 ggagtaatatttatattggattgatccgccatgagaatactacatagtaaaagttatgaaaagtgtcataagatattctcatagtgatagtggtgtattc 17684311  T
223 cacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggtt 322  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
17684310 cacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggtt 17684211  T
323 gatgggtactccatgaatcatg 344  Q
    ||||||||||||||||||||||    
17684210 gatgggtactccatgaatcatg 17684189  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 310; E-Value: 1e-174
Query Start/End: Original strand, 23 - 344
Target Start/End: Complemental strand, 27381293 - 27380972
Alignment:
23 atcatcaaagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatatta 122  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
27381293 atcattaaagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatatta 27381194  T
123 ggagtaatatttatattggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattc 222  Q
    |||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
27381193 ggagtaatatttatattggattgatccgccatgagaatactacatagtaaaagttatgaaaagtgtcataagatattctcatagtgatagtggtgtattc 27381094  T
223 cacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggtt 322  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
27381093 cacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggtt 27380994  T
323 gatgggtactccatgaatcatg 344  Q
    ||||||||||||||||||||||    
27380993 gatgggtactccatgaatcatg 27380972  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 310; E-Value: 1e-174
Query Start/End: Original strand, 23 - 344
Target Start/End: Complemental strand, 27471676 - 27471355
Alignment:
23 atcatcaaagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatatta 122  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
27471676 atcattaaagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatatta 27471577  T
123 ggagtaatatttatattggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattc 222  Q
    |||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
27471576 ggagtaatatttatattggattgatccgccatgagaatactacatagtaaaagttatgaaaagtgtcataagatattctcatagtgatagtggtgtattc 27471477  T
223 cacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggtt 322  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
27471476 cacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggtt 27471377  T
323 gatgggtactccatgaatcatg 344  Q
    ||||||||||||||||||||||    
27471376 gatgggtactccatgaatcatg 27471355  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 302; E-Value: 1e-170
Query Start/End: Original strand, 23 - 344
Target Start/End: Original strand, 11651889 - 11652210
Alignment:
23 atcatcaaagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatatta 122  Q
    ||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
11651889 atcattaaagcatagagactattatgtgggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatatta 11651988  T
123 ggagtaatatttatattggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattc 222  Q
    |||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||    
11651989 ggagtaatatttatattggattgatccgccatgagaatactacatagtaaaagttatgaaaagtgtcataagatattctcataatgatagtggtgtattc 11652088  T
223 cacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggtt 322  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
11652089 cacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggtt 11652188  T
323 gatgggtactccatgaatcatg 344  Q
    ||||||||||||||||||||||    
11652189 gatgggtactccatgaatcatg 11652210  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 302; E-Value: 1e-170
Query Start/End: Original strand, 23 - 344
Target Start/End: Complemental strand, 17691481 - 17691160
Alignment:
23 atcatcaaagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatatta 122  Q
    ||||| |||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||    
17691481 atcattaaagcataaagactattatgtaggtagactgatgatcacatctcacatatcatggataaagagttatcaagtcttcacatagatataaatatta 17691382  T
123 ggagtaatatttatattggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattc 222  Q
    |||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
17691381 ggagtaatatttatattggattgatccgccatgagaatactacatagtaaaagttatgaaaagtgtcataagatattctcatagtgatagtggtgtattc 17691282  T
223 cacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggtt 322  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
17691281 cacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggtt 17691182  T
323 gatgggtactccatgaatcatg 344  Q
    ||||||||||||||||||||||    
17691181 gatgggtactccatgaatcatg 17691160  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 298; E-Value: 1e-167
Query Start/End: Original strand, 23 - 344
Target Start/End: Original strand, 29309056 - 29309377
Alignment:
23 atcatcaaagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatatta 122  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||    
29309056 atcattaaagcatagagactattatgtaggtagactgatgatcacatctcacatatcatggataaagagttatcaagtcttcacatagatataaatatta 29309155  T
123 ggagtaatatttatattggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattc 222  Q
    |||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
29309156 ggagtaatatttatattggattgatccgccatgagaatactacatagtaaaagttatgaaaagtgtcataagatattctcatagtgatagtggtgtattc 29309255  T
223 cacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggtt 322  Q
    ||||||||||||||||||||||||||||||||||||||||||||  ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
29309256 cacccttcgacctgaaaccactatgtaccctagatgttggagtcaggtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggtt 29309355  T
323 gatgggtactccatgaatcatg 344  Q
    ||||||||||||||||||||||    
29309356 gatgggtactccatgaatcatg 29309377  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #7
Raw Score: 298; E-Value: 1e-167
Query Start/End: Original strand, 23 - 344
Target Start/End: Original strand, 29316016 - 29316336
Alignment:
23 atcatcaaagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatatta 122  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||    
29316016 atcattaaagcatagagactattatgtaggtagactgatgatcacatctcacatatcatggataaagagttatcaagtcttcacatagatataaatatta 29316115  T
123 ggagtaatatttatattggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattc 222  Q
    |||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
29316116 ggagtaatatttatattggattgatccgccatgagaatactacatagtaaaagttatgaaaagtgtcataagatattctcatagtgatagtggtgtattc 29316215  T
223 cacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggtt 322  Q
    |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
29316216 cacccttcgacctgaaaccactatgtaccctagatgttggagtc-agtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggtt 29316314  T
323 gatgggtactccatgaatcatg 344  Q
    ||||||||||||||||||||||    
29316315 gatgggtactccatgaatcatg 29316336  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #8
Raw Score: 266; E-Value: 1e-148
Query Start/End: Original strand, 23 - 344
Target Start/End: Complemental strand, 189018 - 188697
Alignment:
23 atcatcaaagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatatta 122  Q
    ||||| ||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||    
189018 atcattaaagcatagagactattatgtgggtagactgatgatcacatctcacatatcatggataaagagttatcaagtcttcacatagatataaatatta 188919  T
123 ggagtaatatttatattggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattc 222  Q
    |||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
188918 ggagtaatatttatattggattgatccgccatgagaatactacatagtaaaagttatgaaaagtgtcataagatattctcatagtgatagtggtgtattc 188819  T
223 cacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggtt 322  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||  ||||| ||||||| ||||||||||||||| ||    
188818 cacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgttatcattcaaatattgtctgtaacagaatgactataaagttgatt 188719  T
323 gatgggtactccatgaatcatg 344  Q
    ||||| |||||||| |||||||    
188718 gatggatactccataaatcatg 188697  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #9
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 105 - 344
Target Start/End: Original strand, 27296877 - 27297116
Alignment:
105 acatagatataaatattaggagtaatatttatattggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcat 204  Q
    |||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||    
27296877 acattgatataaatattaggagtaatatttatattggattgatccgccatgagaatactacatagtaaaagttatgaaaagtgtcataagatattctcat 27296976  T
205 agtgatagtggtgtattccacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacagg 304  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
27296977 agtgatagtggtgtattccacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacagg 27297076  T
305 atgactataaagttggttgatgggtactccatgaatcatg 344  Q
    ||||||||||||||||||||||||||||||||||||||||    
27297077 atgactataaagttggttgatgggtactccatgaatcatg 27297116  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #10
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 71 - 344
Target Start/End: Complemental strand, 16394438 - 16394165
Alignment:
71 tcacagatcatggataaagagttatcaagtcttcacatagatataaatattaggagtaatatttatattggattgatccgtcatgagaatactacatagt 170  Q
    ||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||  |||||||||||||| ||||    
16394438 tcacatatcatggataaacagttatcaagtcttcacatagatataaatattaggagtaatatttatattggattgacccaccatgagaatactacgtagt 16394339  T
171 aaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattccacccttcgacctgaaaccactatgtaccctagatgttggagtcgagt 270  Q
    ||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||| ||||||    
16394338 aaaagttatgaaaagtgtcataagatattcttatagtgatagtggtgtattccaccctttgacttgaaaccactatgtaccctagatgttggaatcgagt 16394239  T
271 gctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggttgatgggtactccatgaatcatg 344  Q
    ||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||    
16394238 gctttgtcaccattcaaacgttgtctgtaacaagatgactataaagttggttgatgggtactccatgaatcatg 16394165  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #11
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 103 - 340
Target Start/End: Complemental strand, 25537152 - 25536915
Alignment:
103 tcacatagatataaatattaggagtaatatttatattggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctc 202  Q
    |||||||||||||||||||||| || |||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||    
25537152 tcacatagatataaatattaggtgtcatatttatattggattgatccgccatgagaatactacatagtaaaagttatgaaaagtgtcataagatattctc 25537053  T
203 atagtgatagtggtgtattccacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaaca 302  Q
    ||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
25537052 atagtgacagtggtgtattccacccttcgacctgaaaccactatttaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaaca 25536953  T
303 ggatgactataaagttggttgatgggtactccatgaat 340  Q
    |||||| |||||||||||||||||||||||||||||||    
25536952 ggatgattataaagttggttgatgggtactccatgaat 25536915  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #12
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 122 - 343
Target Start/End: Complemental strand, 16559414 - 16559193
Alignment:
122 aggagtaatatttatattggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtatt 221  Q
    ||||||||||||||||||||||||||||  |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||    
16559414 aggagtaatatttatattggattgatccaccatgagaatactacatagtaaaagttatgaaaagtgtcataagatattctcatagtgatagtggtgtatt 16559315  T
222 ccacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggt 321  Q
    |||||||||||||||||||| ||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||    
16559314 ccacccttcgacctgaaaccgctatgtaccgtagatgttggagtcgagtgttttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggt 16559215  T
322 tgatgggtactccatgaatcat 343  Q
    ||||||||||||||||||||||    
16559214 tgatgggtactccatgaatcat 16559193  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #13
Raw Score: 124; E-Value: 1e-63
Query Start/End: Original strand, 19 - 327
Target Start/End: Complemental strand, 13359314 - 13359010
Alignment:
19 ggacatcatcaaagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaat 118  Q
    ||||| ||| ||||| ||||||||||||| | | |||||||||||||||||||| || |||||||||||| ||||||||| ||||||| ||||||||| |    
13359314 ggacaacattaaagcgtagagactattatatggatagactgatgatcacatctcgcaaatcatggataaaaagttatcaaatcttcacttagatataagt 13359215  T
119 attaggagtaatatttatattggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgata-gtggtg 217  Q
    ||||| |||| ||||||||||| ||||   |  |||||  ||||||||| | |||  ||||  ||| ||||||||  |||||||||||||||| ||||||    
13359214 attagaagtagtatttatattgaattgtctcaccatga--atactacattgaaaa--ttatgtaaa-tgtcataaattattctcatagtgataagtggtg 13359120  T
218 tattccacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagt 317  Q
    |||||||||||||||||||||||||||||||||| ||||||| ||||||||||  |||||  || | ||||| | |||||||||||||||||||||||||    
13359119 tattccacccttcgacctgaaaccactatgtaccttagatgtaggagtcgagtattttgttgccgtacaaacatcgtccgtaacaggatgactataaagt 13359020  T
318 tggttgatgg 327  Q
     |||||||||    
13359019 cggttgatgg 13359010  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #14
Raw Score: 101; E-Value: 5e-50
Query Start/End: Original strand, 23 - 127
Target Start/End: Complemental strand, 16566361 - 16566257
Alignment:
23 atcatcaaagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatatta 122  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
16566361 atcattaaagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatatta 16566262  T
123 ggagt 127  Q
    |||||    
16566261 ggagt 16566257  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #15
Raw Score: 93; E-Value: 3e-45
Query Start/End: Original strand, 40 - 334
Target Start/End: Original strand, 2669476 - 2669768
Alignment:
40 actattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatattaggagtaatatttatatt 139  Q
    |||||||| | |||||| ||||||||||||||||   ||||| ||| ||||||||||| || ||||||||||||||||||||||||||||||||||||||    
2669476 actattatatgggtagattgatgatcacatctcatgaatcattgattaagagttatcatgtattcacatagatataaatattaggagtaatatttatatt 2669575  T
140 ggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtga-tagtggtgtattccacccttcgacctgaa 238  Q
     ||||||  | |||||| ||||||||||||  || ||| |   |||| ||||||| ||||||||||||||  ||| |||||||||||  || ||||||||    
2669576 tgattgacacatcatgaaaatactacatag--aatgttgt-ttaagtatcataagttattctcatagtgacaagttgtgtattccactatttgacctgaa 2669672  T
239 accactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggttgatgggtactcc 334  Q
    | || ||||||| |||||||| ||||||  || ||||||   | |||||| ||| ||  ||||||||||||||||||||  |||||| ||||||||    
2669673 atcattatgtactctagatgtaggagtccggtactttgttgtcgttcaaatgttatctataacaggatgactataaagtcagttgattggtactcc 2669768  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #16
Raw Score: 93; E-Value: 3e-45
Query Start/End: Original strand, 37 - 344
Target Start/End: Original strand, 16789071 - 16789373
Alignment:
37 gagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatattaggagtaatatttat 136  Q
    |||||||||||||| |||||||||||| | |||||||  | |||| ||||  ||| ||||||||||  ||||||||||||||||||||||||||||||||    
16789071 gagactattatgtatgtagactgatgaccgcatctcatgggtcatagatat-gagatatcaagtctatacatagatataaatattaggagtaatatttat 16789169  T
137 attggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattccacccttcgacctg 236  Q
    |||||||||| ||    |||||||||||||||||  |||||||  ||| |||||||||||||||||| | ||||| |  |||||  | | ||| ||||||    
16789170 attggattgacccactgtgagaatactacatagt--aagttat-gaaattgtcataagatattctcacaatgataataatgtatatcgctcttagacctg 16789266  T
237 aaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggttgatgggtactccat 336  Q
    |||||||||||  | ||||||| |||| || ||||||||||   ||||| ||||||||| |||| ||||| || |||| ||||||||||||| |||  ||    
16789267 aaaccactatgatctctagatg-tggactcaagtgctttgttgtcattctaacgttgtctgtaaaaggataacaataacgttggttgatgggcacttgat 16789365  T
337 gaatcatg 344  Q
    ||||||||    
16789366 gaatcatg 16789373  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #17
Raw Score: 93; E-Value: 3e-45
Query Start/End: Original strand, 37 - 344
Target Start/End: Complemental strand, 22860190 - 22859888
Alignment:
37 gagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatattaggagtaatatttat 136  Q
    |||||||||||||| |||||||||||| | |||||||  | |||| ||||  ||| ||||||||||  ||||||||||||||||||||||||||||||||    
22860190 gagactattatgtatgtagactgatgaccgcatctcatgggtcatagatat-gagatatcaagtctatacatagatataaatattaggagtaatatttat 22860092  T
137 attggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattccacccttcgacctg 236  Q
    |||||||||| ||    |||||||||||||||||  |||||||  ||| |||||||||||||||||| | ||||| |  |||||  | | ||| ||||||    
22860091 attggattgacccactgtgagaatactacatagt--aagttat-gaaattgtcataagatattctcacaatgataataatgtatatcgctcttagacctg 22859995  T
237 aaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggttgatgggtactccat 336  Q
    |||||||||||  | ||||||| |||| || |||| |||||  |||||| ||||||||| |||| ||||| || |||| ||||||||||||| |||  ||    
22859994 aaaccactatgatctctagatg-tggactcaagtgttttgttgccattctaacgttgtctgtaaaaggataacaataacgttggttgatgggcacttgat 22859896  T
337 gaatcatg 344  Q
    ||||||||    
22859895 gaatcatg 22859888  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #18
Raw Score: 93; E-Value: 3e-45
Query Start/End: Original strand, 37 - 344
Target Start/End: Complemental strand, 27508649 - 27508347
Alignment:
37 gagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatattaggagtaatatttat 136  Q
    |||||| ||||||| |||||||||||| | |||||||  | |||| ||||  ||| ||||||||||  |||||||||||||||||||||||||||||| |    
27508649 gagactgttatgtatgtagactgatgaccgcatctcatgggtcatagatat-gagatatcaagtctatacatagatataaatattaggagtaatatttgt 27508551  T
137 attggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattccacccttcgacctg 236  Q
    |||||||||| ||    |||||||||||||||||  ||||||| |||| |||||||||||||||||| | ||||| |  |||||  | | ||| ||||||    
27508550 attggattgacccactgtgagaatactacatagt--aagttatgaaaa-tgtcataagatattctcacaatgataataatgtatatcgctcttagacctg 27508454  T
237 aaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggttgatgggtactccat 336  Q
    |||||||||||  | ||||||| |||| || ||||||||||  |||||| ||||||||| |||| ||||| |  |||| |||||||||||||||||  ||    
27508453 aaaccactatgatctctagatg-tggattcaagtgctttgttgccattctaacgttgtctgtaaaaggataaaaataacgttggttgatgggtacttgat 27508355  T
337 gaatcatg 344  Q
    ||||||||    
27508354 gaatcatg 27508347  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #19
Raw Score: 89; E-Value: 8e-43
Query Start/End: Original strand, 37 - 344
Target Start/End: Complemental strand, 1586410 - 1586108
Alignment:
37 gagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatattaggagtaatatttat 136  Q
    |||||||||||||| |||||||||||| | |||||||  | |||| ||||  ||| ||| ||||||  ||||||||||||||||||| ||||||||||||    
1586410 gagactattatgtatgtagactgatgaccgcatctcatgggtcatagatat-gagatattaagtctatacatagatataaatattagaagtaatatttat 1586312  T
137 attggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattccacccttcgacctg 236  Q
    |||||||||| ||    |||||||||||||||||  |||||||  ||| |||||||||||||||||| | ||||| |  |||||    | ||| ||||||    
1586311 attggattgacccactgtgagaatactacatagt--aagttat-gaaattgtcataagatattctcacaatgataataatgtatattgctcttagacctg 1586215  T
237 aaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggttgatgggtactccat 336  Q
    |||||||||||  | ||||||| |||| || ||||||||||  |||||| ||||||||| |||| ||||| || |||| |||||||||||||||||  ||    
1586214 aaaccactatgatctctagatg-tggactcaagtgctttgttgccattctaacgttgtctgtaaaaggataacaataacgttggttgatgggtacttgat 1586116  T
337 gaatcatg 344  Q
    ||||||||    
1586115 gaatcatg 1586108  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #20
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 37 - 330
Target Start/End: Complemental strand, 27528235 - 27527947
Alignment:
37 gagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatattaggagtaatatttat 136  Q
    |||||| ||||||| |||||||||||| | |||||||  | |||| ||||  ||| ||||||||||  |||||||||||||||||||||||||||||| |    
27528235 gagactgttatgtatgtagactgatgaccgcatctcatgggtcatagatat-gagatatcaagtctatacatagatataaatattaggagtaatatttgt 27528137  T
137 attggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattccacccttcgacctg 236  Q
    |||||||||| ||    |||||||||||||||||  ||||||| |||| |||||||||||||||||| | ||||| |  |||||  | | ||| ||||||    
27528136 attggattgacccactgtgagaatactacatagt--aagttatgaaaa-tgtcataagatattctcacaatgataataatgtatatcgctcttagacctg 27528040  T
237 aaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggttgatgggta 330  Q
    |||||||||||  | ||||||| |||| || ||||||||||  |||||| ||||||||| |||| ||||| |  |||| |||||||||||||||    
27528039 aaaccactatgatctctagatg-tggattcaagtgctttgttgccattctaacgttgtctgtaaaaggataaaaataacgttggttgatgggta 27527947  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #21
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 37 - 344
Target Start/End: Original strand, 14074480 - 14074782
Alignment:
37 gagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatattaggagtaatatttat 136  Q
    |||||||||||||| |||||||||||| | |||||||  | |||| ||||  ||| ||| ||||||  |||||| |||||||||| ||||||||||||||    
14074480 gagactattatgtatgtagactgatgaccgcatctcatgggtcatagatat-gagatattaagtctatacataggtataaatattgggagtaatatttat 14074578  T
137 attggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattccacccttcgacctg 236  Q
    | |||||||| ||  | |||||||||||||||||  |||||||  ||| |||||||||||||| ||| | |||||   ||||||    | ||| ||||||    
14074579 aatggattgacccaccgtgagaatactacatagt--aagttat-gaaattgtcataagatattttcacaatgataaaagtgtatattgctcttagacctg 14074675  T
237 aaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggttgatgggtactccat 336  Q
    |||||||||||  ||||||||| | || || ||||||||||  || ||| ||| ||||| |||| ||||| || |||| |||||||||||||||||  ||    
14074676 aaaccactatgatccctagatg-tagactcaagtgctttgttgcctttctaacattgtctgtaaaaggataaccataacgttggttgatgggtacttgat 14074774  T
337 gaatcatg 344  Q
    ||||||||    
14074775 gaatcatg 14074782  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #22
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 37 - 300
Target Start/End: Complemental strand, 18020143 - 18019885
Alignment:
37 gagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatattaggagtaatatttat 136  Q
    |||||||||||||| |||||||||||| | |||||||  | |||| ||||  ||| ||||||||||  ||||||||||||||||||||||||||||||||    
18020143 gagactattatgtatgtagactgatgaccgcatctcatgggtcatagatat-gagatatcaagtctatacatagatataaatattaggagtaatatttat 18020045  T
137 attggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattccacccttcgacctg 236  Q
    |||||||||| ||  | |||||||||||||||||  |||||||  ||| |||||||||||||||||| | ||||| |  |||||  | | ||| ||||||    
18020044 attggattgacccaccgtgagaatactacatagt--aagttat-gaaattgtcataagatattctcacaatgataataatgtatatcgctcttagacctg 18019948  T
237 aaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaa 300  Q
    ||| |||||||  | ||||||| | || || ||| ||||||  |||||| ||||||||| ||||    
18019947 aaatcactatgatctctagatg-tcgactcaagtactttgttgccattctaacgttgtctgtaa 18019885  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #23
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 29 - 322
Target Start/End: Complemental strand, 10359359 - 10359073
Alignment:
29 aaagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatattaggagta 128  Q
    ||||| ||||||||||||| || ||||| |||||| |||||||||  | ||||| ||   ||| ||| ||||||  ||||||||||||||||||   |||    
10359359 aaagcgtagagactattatatatgtagagtgatgaccacatctcatgg-tcatgaatgt-gagatattaagtctatacatagatataaatattataggta 10359262  T
129 atatttatattggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattccaccct 228  Q
    ||||||||| ||||| || ||  | ||| ||||||||||||||   ||||| ||  ||||||||||||||||||| | ||||| |||||||| |||| ||    
10359261 atatttatactggatcgacccaccgtgaaaatactacatagtat--gttatgaa--gtgtcataagatattctcacaatgataatggtgtataccactct 10359166  T
229 tcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggtt 322  Q
    | ||| |||||||||||||  ||||||||| |||| ||| ||||||| |   ||||||||| |||||||||||||||| || || |||||||||    
10359165 tagacttgaaaccactatgatccctagatg-tggactcgtgtgctttattgtcattcaaacattgtccgtaacaggataaccattaagttggtt 10359073  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #24
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 37 - 344
Target Start/End: Original strand, 8612915 - 8613221
Alignment:
37 gagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatattaggagtaatatttat 136  Q
    |||||||||||||| |||||||||||| | |||||||  | | || ||||  ||| ||| ||||||  |||||| |||||||||||||||||||||||||    
8612915 gagactattatgtatgtagactgatgaccgcatctcatgggttatagatat-gagatattaagtctatacataggtataaatattaggagtaatatttat 8613013  T
137 attggattgatccgtcatgagaatactacatagtaaaagttataaaa---agtgtcataagatattctcatagtgatagtggtgtattccacccttcgac 233  Q
    | ||||| || ||  | ||||||||||||||||||   ||||| | |   | |||||||||||||||||| | ||||| | ||||||  | | ||| |||    
8613014 actggatagacccaccgtgagaatactacatagtac--gttatgagattaattgtcataagatattctcacaatgataatagtgtatatcgctcttagac 8613111  T
234 ctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggttgatgggtactc 333  Q
    ||||||||||||||  ||||||||| |||| || |||  |||||  || ||| ||||||||| |||| ||||| || ||||  ||||||||||||||||     
8613112 ctgaaaccactatgatccctagatg-tggactcaagtattttgtttcccttctaacgttgtctgtaaaaggataaccataacattggttgatgggtactt 8613210  T
334 catgaatcatg 344  Q
     ||||||||||    
8613211 gatgaatcatg 8613221  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #25
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 38 - 166
Target Start/End: Original strand, 27925935 - 27926062
Alignment:
38 agactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatattaggagtaatatttata 137  Q
    |||||||||||| | || |||||||||| |||||||| ||||||||||||||| |||| |||| ||||||||||||| || ||||||| |||||||||||    
27925935 agactattatgtggataaactgatgatctcatctcacggatcatggataaagatttatgaagttttcacatagatattaa-attaggaataatatttata 27926033  T
138 ttggattgatccgtcatgagaatactaca 166  Q
    ||| |||||  || ||||| |||||||||    
27926034 ttgaattgactcgccatgataatactaca 27926062  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #26
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 38 - 241
Target Start/End: Complemental strand, 17850521 - 17850321
Alignment:
38 agactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatattaggagtaatatttata 137  Q
    |||||||||| | |||||||||||||||| |||| | ||||||| || || ||||||||  || ||||||||| ||||||||||| ||||||||| ||||    
17850521 agactattatatgggtagactgatgatcatatcttatagatcattgacaacgagttatcgtgtattcacataggtataaatattatgagtaatatatata 17850422  T
138 ttggattgatccgtcatgagaatactacatagtaaaagttata-aaaagtgtcataagatattctcatagtgatagtggtgtattccacccttcgacctg 236  Q
    ||||||||| ||  | | |||||||||||| |     ||| ||   |||| ||||||| |||||| |||||||||||| ||||| |||||||| ||||||    
17850421 ttggattgaccctccttaagaatactacattg----ggttttatgtaagtatcataagttattcttatagtgatagtgatgtataccaccctttgacctg 17850326  T
237 aaacc 241  Q
    |||||    
17850325 aaacc 17850321  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #27
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 107 - 259
Target Start/End: Complemental strand, 20736562 - 20736413
Alignment:
107 atagatataaatattaggagtaatatttatattggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatag 206  Q
    |||| |||||||||||||||||||||||||| ||||||||||| || ||||||||||||||| |  | | ||| |||| |||||||||||||||||| ||    
20736562 ataggtataaatattaggagtaatatttatactggattgatccatcgtgagaatactacatatt--atgctatgaaaa-tgtcataagatattctcacag 20736466  T
207 tgatagtggtgtattccacccttcgacctgaaaccactatgtaccctagatgt 259  Q
    ||||| | ||||||  ||| ||| ||||| |||| ||||||  ||||||||||    
20736465 tgataatagtgtatatcactcttagacctaaaactactatgatccctagatgt 20736413  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #28
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 55 - 160
Target Start/End: Original strand, 28172754 - 28172859
Alignment:
55 gactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatattaggagtaatatttatattggattgatccgtcat 154  Q
    ||||||||||||||||| ||||||||| | |||| |||||||||||||| |||||||||||||||||| | ||| | ||||||||||||||| ||  |||    
28172754 gactgatgatcacatcttacagatcattgttaaaaagttatcaagtctttacatagatataaatattaagggtagtgtttatattggattgaccctccat 28172853  T
155 gagaat 160  Q
    ||||||    
28172854 gagaat 28172859  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #29
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 29 - 161
Target Start/End: Complemental strand, 20553622 - 20553492
Alignment:
29 aaagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatattaggagta 128  Q
    |||||||| ||| | |||||| ||||||||||||||||||||||||| ||||| ||||||||  ||||||   ||||||||||||| ||||||| || ||    
20553622 aaagcataaagatttttatgttggtagactgatgatcacatctcacatatcatcgataaagaaatatcaaacattcacatagatat-aatattaagaata 20553524  T
129 atatttatattggattgatccgtcatgagaata 161  Q
    ||||||||||| |||||| || |||||||||||    
20553523 atatttatatt-gattgacccatcatgagaata 20553492  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #30
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 90 - 275
Target Start/End: Original strand, 8510155 - 8510338
Alignment:
90 agttatcaagtcttcacatagatataaa-tattaggagtaatatttatattggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgt 188  Q
    ||||||||  |||||| ||||||| ||| |||||| ||||||||||||||| |||||| |    |||| ||||||||||||  || |||||  || ||||    
8510155 agttatcatttcttcatatagataaaaaatattagaagtaatatttatatttgattgacctacaatgataatactacatag--aatgttatgtaa-gtgt 8510251  T
189 cataagatattctcatagtgatagtggtgtattccacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgcttt 275  Q
    ||| || || |||||||||||| |||||| ||| ||  ||||| |||| |||||||||||||| ||||||| |||||||||| ||||    
8510252 cattagttactctcatagtgatggtggtgcattacatgcttcggcctggaaccactatgtaccttagatgtaggagtcgagtacttt 8510338  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #31
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 231 - 344
Target Start/End: Original strand, 33317055 - 33317167
Alignment:
231 gacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggttgatgggta 330  Q
    |||||||||||||||||  |||||||||| ||| || ||| ||||||  |||||| ||||||||| |||| ||||| || |||| |||||||||||||||    
33317055 gacctgaaaccactatgatccctagatgt-ggactcaagtactttgtttccattctaacgttgtctgtaaaaggataaccataacgttggttgatgggta 33317153  T
331 ctccatgaatcatg 344  Q
    ||  ||||||||||    
33317154 cttgatgaatcatg 33317167  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #32
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 105 - 344
Target Start/End: Complemental strand, 17120740 - 17120505
Alignment:
105 acatagatataaatattaggagtaatatttatattggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcat 204  Q
    |||||| |||||||| |||||||| |||||||| |||||||| ||    ||||||| ||| ||||||   ||||| |||  ||||||||||||||||||     
17120740 acataggtataaatactaggagtagtatttatactggattgacccactgtgagaatgctaaatagtat--gttatgaaat-tgtcataagatattctcac 17120644  T
205 agtgatagtggtgtattccacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacagg 304  Q
    | ||||| |  |||||  | | ||| |||||||||||||||||  ||||| |||| ||| || ||||||||||   ||||| ||||||||| || | |||    
17120643 aatgataataatgtatatcgctcttagacctgaaaccactatgatccctatatgt-ggactcaagtgctttgttgtcattctaacgttgtctgtcaaagg 17120545  T
305 atgactataaagttggttgatgggtactccatgaatcatg 344  Q
    || || |||| |||||||||||||| ||  ||||||||||    
17120544 ataaccataacgttggttgatgggtgcttgatgaatcatg 17120505  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #33
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 23 - 75
Target Start/End: Complemental strand, 25537200 - 25537148
Alignment:
23 atcatcaaagcatagagactattatgtaggtagactgatgatcacatctcaca 75  Q
    ||||| |||||||| ||||||||||||||||||||||||||||||||||||||    
25537200 atcattaaagcataaagactattatgtaggtagactgatgatcacatctcaca 25537148  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #34
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 37 - 132
Target Start/End: Complemental strand, 13995245 - 13995151
Alignment:
37 gagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatattaggagtaatat 132  Q
    |||||||||||||| |||||||||||| | |||||||  | |||| ||||  ||| ||||||||||  ||||||||||||||||||||||||||||    
13995245 gagactattatgtatgtagactgatgaccgcatctcatgggtcatagatat-gagatatcaagtctatacatagatataaatattaggagtaatat 13995151  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #35
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 105 - 247
Target Start/End: Original strand, 21994655 - 21994794
Alignment:
105 acatagatataaatattaggagtaatatttatattggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcat 204  Q
    |||||| |||||| |||| |||||||||||||| |||| ||| ||  ||||||||||||| |||||  | ||||| |||| |||||||||||||| |||     
21994655 acatagctataaacattacgagtaatatttatactggaatgacccaccatgagaatactaaatagt--atgttatgaaaa-tgtcataagatattttcac 21994751  T
205 agtgatagtggtgtattccacccttcgacctgaaaccactatg 247  Q
    | ||||| ||||||||  ||| ||| |||||||||| ||||||    
21994752 aatgataatggtgtatatcactcttagacctgaaacgactatg 21994794  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #36
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 35 - 247
Target Start/End: Original strand, 19218427 - 19218630
Alignment:
35 tagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatattaggagtaatattt 134  Q
    |||||||||||||||| |||||||||||| |||| ||||  | ||||| || | ||| ||| ||||||  |||||  |||||||||||||||||| ||||    
19218427 tagagactattatgtatgtagactgatgaccacacctcatgggtcatgaat-atgagatattaagtctatacatatgtataaatattaggagtaaaattt 19218525  T
135 atattggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattccacccttcgacc 234  Q
    ||     ||||| ||  | |||||||||||||||||  | ||||| |||| | |||||||||||||||| | ||||| || | ||| | || ||| ||||    
19218526 at-----attgacccaccgtgagaatactacatagt--atgttatgaaaa-tttcataagatattctcagaatgataatgatatatactactcttagacc 19218617  T
235 tgaaaccactatg 247  Q
    |||||||||||||    
19218618 tgaaaccactatg 19218630  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #37
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 51 - 172
Target Start/End: Complemental strand, 19347212 - 19347092
Alignment:
51 ggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatattaggagtaatatttatattggattgatccg 150  Q
    |||||| |||||| || |||||||| ||||| ||||||||||| ||| || ||||||||  |||||| |||| || |||||||| || |||||||| | |    
19347212 ggtagattgatgaccatatctcacatatcattgataaagagttgtcatgttttcacataagtataaacatta-gaataatatttgtaatggattgaactg 19347114  T
151 tcatgagaatactacatagtaa 172  Q
     ||| |||||||||||||||||    
19347113 ccattagaatactacatagtaa 19347092  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #38
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 36 - 216
Target Start/End: Complemental strand, 22560487 - 22560311
Alignment:
36 agagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatattaggagtaatattta 135  Q
    ||||||||||||| | |||||| ||||| |||||||||  | |||||||||  ||| ||| |||| |  |||||| | ||||||||||||||||||||||    
22560487 agagactattatgcatgtagaccgatgaccacatctcatgggtcatggatat-gagatattaagtttatacataggtttaaatattaggagtaatattta 22560389  T
136 tattggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggt 216  Q
    || || ||||| |    ||||||| ||||||||||  | ||||| |||| |||||||||||||||||| | ||||| ||||    
22560388 tactgtattgacctactatgagaacactacatagt--atgttatgaaaa-tgtcataagatattctcacaatgataatggt 22560311  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #39
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 203 - 266
Target Start/End: Original strand, 28172899 - 28172963
Alignment:
203 atagtgata-gtggtgtattccacccttcgacctgaaaccactatgtaccctagatgttggagtc 266  Q
    ||||||||| ||||||||||||||||||||||| ||||||| |||||||||||||| | ||||||    
28172899 atagtgataagtggtgtattccacccttcgaccggaaaccagtatgtaccctagatataggagtc 28172963  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #40
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 188 - 327
Target Start/End: Complemental strand, 28756283 - 28756145
Alignment:
188 tcataagatattctcatagtgatagtggtgtattccacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaa 287  Q
    |||||| ||||||||||||||||| || | |||  || |||  |||||||||||||| |||||| || |||| ||||||  || |||| |||||| ||||    
28756283 tcataaaatattctcatagtgataatgatttatctcatcctatgacctgaaaccactgtgtaccatatatgtaggagtcatgtactttatcacca-tcaa 28756185  T
288 acgttgtccgtaacaggatgactataaagttggttgatgg 327  Q
    | |||||  |||||| |||| ||||||||| |||||||||    
28756184 atgttgtatgtaacaagatgcctataaagtcggttgatgg 28756145  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #41
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 112 - 259
Target Start/End: Complemental strand, 5758709 - 5758565
Alignment:
112 tataaatattaggagtaatatttatattggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgata 211  Q
    |||||||||||||||||||||||||| ||||| |||||    |||||||||||||||||  | |||||  | | || ||||||||||||||| | | |||    
5758709 tataaatattaggagtaatatttatactggatagatccactgtgagaatactacatagt--acgttat-gagattgccataagatattctcacaattata 5758613  T
212 gtggtgtattccacccttcgacctgaaaccactatgtaccctagatgt 259  Q
     | ||||||  | | ||| |||||||||||||||||  ||||||||||    
5758612 atagtgtatatcgctcttagacctgaaaccactatgatccctagatgt 5758565  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #42
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 35 - 247
Target Start/End: Original strand, 4073574 - 4073781
Alignment:
35 tagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatattaggagtaatattt 134  Q
    |||||||||||||||  ||||| ||| ||||||||| || || ||||| |||  ||| ||| ||||||  |||||  | ||||||||||  |||||||||    
4073574 tagagactattatgtttgtagattgaggatcacatcccataggtcatgaatat-gagatattaagtctatacataagtgtaaatattagaggtaatattt 4073672  T
135 atattggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattccacccttcgacc 234  Q
    ||||| |||||| |   | |||||||||||||||  | | ||||| ||||   |||||||||||||||||| |||||  | ||||| |||  ||| ||||    
4073673 atatttgattgacctaccgtgagaatactacata--atatgttatgaaaa--ttcataagatattctcataatgataacgatgtataccaatcttagacc 4073768  T
235 tgaaaccactatg 247  Q
    | |||||||||||    
4073769 taaaaccactatg 4073781  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #43
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 37 - 73
Target Start/End: Complemental strand, 20736630 - 20736594
Alignment:
37 gagactattatgtaggtagactgatgatcacatctca 73  Q
    |||||||||||||| |||||||||||| |||||||||    
20736630 gagactattatgtatgtagactgatgaccacatctca 20736594  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 310; Significance: 1e-174; HSPs: 57)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 310; E-Value: 1e-174
Query Start/End: Original strand, 23 - 344
Target Start/End: Original strand, 18262378 - 18262699
Alignment:
23 atcatcaaagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatatta 122  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
18262378 atcattaaagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatatta 18262477  T
123 ggagtaatatttatattggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattc 222  Q
    |||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
18262478 ggagtaatatttatattggattgatccgccatgagaatactacatagtaaaagttatgaaaagtgtcataagatattctcatagtgatagtggtgtattc 18262577  T
223 cacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggtt 322  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
18262578 cacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggtt 18262677  T
323 gatgggtactccatgaatcatg 344  Q
    ||||||||||||||||||||||    
18262678 gatgggtactccatgaatcatg 18262699  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 310; E-Value: 1e-174
Query Start/End: Original strand, 23 - 344
Target Start/End: Original strand, 18269239 - 18269560
Alignment:
23 atcatcaaagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatatta 122  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
18269239 atcattaaagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatatta 18269338  T
123 ggagtaatatttatattggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattc 222  Q
    |||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
18269339 ggagtaatatttatattggattgatccgccatgagaatactacatagtaaaagttatgaaaagtgtcataagatattctcatagtgatagtggtgtattc 18269438  T
223 cacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggtt 322  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
18269439 cacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggtt 18269538  T
323 gatgggtactccatgaatcatg 344  Q
    ||||||||||||||||||||||    
18269539 gatgggtactccatgaatcatg 18269560  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 310; E-Value: 1e-174
Query Start/End: Original strand, 23 - 344
Target Start/End: Original strand, 55612849 - 55613170
Alignment:
23 atcatcaaagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatatta 122  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
55612849 atcattaaagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatatta 55612948  T
123 ggagtaatatttatattggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattc 222  Q
    |||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
55612949 ggagtaatatttatattggattgatccgccatgagaatactacatagtaaaagttatgaaaagtgtcataagatattctcatagtgatagtggtgtattc 55613048  T
223 cacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggtt 322  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
55613049 cacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggtt 55613148  T
323 gatgggtactccatgaatcatg 344  Q
    ||||||||||||||||||||||    
55613149 gatgggtactccatgaatcatg 55613170  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 306; E-Value: 1e-172
Query Start/End: Original strand, 23 - 344
Target Start/End: Original strand, 26963806 - 26964127
Alignment:
23 atcatcaaagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatatta 122  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
26963806 atcattaaagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatatta 26963905  T
123 ggagtaatatttatattggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattc 222  Q
    | |||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
26963906 gcagtaatatttatattggattgatccgccatgagaatactacatagtaaaagttatgaaaagtgtcataagatattctcatagtgatagtggtgtattc 26964005  T
223 cacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggtt 322  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
26964006 cacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggtt 26964105  T
323 gatgggtactccatgaatcatg 344  Q
    ||||||||||||||||||||||    
26964106 gatgggtactccatgaatcatg 26964127  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 306; E-Value: 1e-172
Query Start/End: Original strand, 23 - 344
Target Start/End: Original strand, 26970629 - 26970950
Alignment:
23 atcatcaaagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatatta 122  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
26970629 atcattaaagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatatta 26970728  T
123 ggagtaatatttatattggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattc 222  Q
    | |||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
26970729 gcagtaatatttatattggattgatccgccatgagaatactacatagtaaaagttatgaaaagtgtcataagatattctcatagtgatagtggtgtattc 26970828  T
223 cacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggtt 322  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
26970829 cacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggtt 26970928  T
323 gatgggtactccatgaatcatg 344  Q
    ||||||||||||||||||||||    
26970929 gatgggtactccatgaatcatg 26970950  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 302; E-Value: 1e-170
Query Start/End: Original strand, 23 - 344
Target Start/End: Original strand, 868763 - 869084
Alignment:
23 atcatcaaagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatatta 122  Q
    ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||    
868763 atcattaaagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaaaagttatcaagtcttcacatagatataaatatta 868862  T
123 ggagtaatatttatattggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattc 222  Q
    |||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||    
868863 ggagtaatatttatattggattgatccgccatgagaatactacatagtaaaagttatgaaaagtgtcataagatattctcatagtgataatggtgtattc 868962  T
223 cacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggtt 322  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
868963 cacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggtt 869062  T
323 gatgggtactccatgaatcatg 344  Q
    ||||||||||||||||||||||    
869063 gatgggtactccatgaatcatg 869084  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 302; E-Value: 1e-170
Query Start/End: Original strand, 23 - 344
Target Start/End: Complemental strand, 19926801 - 19926480
Alignment:
23 atcatcaaagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatatta 122  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||    
19926801 atcattaaagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcaaatagatataaatatta 19926702  T
123 ggagtaatatttatattggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattc 222  Q
    |||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||    
19926701 ggagtaatatttatattggattgatccgccatgagaatactacatagtaaaagttatgaaaaatgtcataagatattctcatagtgatagtggtgtattc 19926602  T
223 cacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggtt 322  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
19926601 cacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggtt 19926502  T
323 gatgggtactccatgaatcatg 344  Q
    ||||||||||||||||||||||    
19926501 gatgggtactccatgaatcatg 19926480  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 298; E-Value: 1e-167
Query Start/End: Original strand, 23 - 344
Target Start/End: Original strand, 5707486 - 5707807
Alignment:
23 atcatcaaagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatatta 122  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
5707486 atcattaaagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatatta 5707585  T
123 ggagtaatatttatattggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattc 222  Q
     ||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
5707586 tgagtaatatttatattggattgatccgccatgagaatactacatagtaaaagttatgaaaagtgtcataagatattctcatagtgatagtggtgtattc 5707685  T
223 cacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggtt 322  Q
    || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||    
5707686 catccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaactttgtccgtaacaggatgactataaagttggtt 5707785  T
323 gatgggtactccatgaatcatg 344  Q
    ||||||||||||||||||||||    
5707786 gatgggtactccatgaatcatg 5707807  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #9
Raw Score: 298; E-Value: 1e-167
Query Start/End: Original strand, 23 - 344
Target Start/End: Original strand, 5714114 - 5714435
Alignment:
23 atcatcaaagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatatta 122  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
5714114 atcattaaagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatatta 5714213  T
123 ggagtaatatttatattggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattc 222  Q
     ||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
5714214 tgagtaatatttatattggattgatccgccatgagaatactacatagtaaaagttatgaaaagtgtcataagatattctcatagtgatagtggtgtattc 5714313  T
223 cacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggtt 322  Q
    || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||    
5714314 catccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaactttgtccgtaacaggatgactataaagttggtt 5714413  T
323 gatgggtactccatgaatcatg 344  Q
    ||||||||||||||||||||||    
5714414 gatgggtactccatgaatcatg 5714435  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #10
Raw Score: 298; E-Value: 1e-167
Query Start/End: Original strand, 23 - 344
Target Start/End: Original strand, 8858333 - 8858654
Alignment:
23 atcatcaaagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatatta 122  Q
    ||||| ||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||    
8858333 atcattaaagcatagagactattatgtgggtaggctgatgatcacatctcacagatcatggataaagagttatcaagtcttcatatagatataaatatta 8858432  T
123 ggagtaatatttatattggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattc 222  Q
    |||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
8858433 ggagtaatatttatattggattgatccgccatgagaatactacatagtaaaagttatgaaaagtgtcataagatattctcatagtgatagtggtgtattc 8858532  T
223 cacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggtt 322  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8858533 cacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggtt 8858632  T
323 gatgggtactccatgaatcatg 344  Q
    ||||||||||||||||||||||    
8858633 gatgggtactccatgaatcatg 8858654  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #11
Raw Score: 298; E-Value: 1e-167
Query Start/End: Original strand, 23 - 344
Target Start/End: Complemental strand, 10621374 - 10621053
Alignment:
23 atcatcaaagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatatta 122  Q
    ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||    
10621374 atcattaaagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatttta 10621275  T
123 ggagtaatatttatattggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattc 222  Q
    |||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||    
10621274 ggagtaatatttatattggattgatccgccatgagaatactacatagtaaaagttatgaaaagtgtcataagatattctcatagtgatagtggtgttttc 10621175  T
223 cacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggtt 322  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||    
10621174 cacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaactttgtccgtaacaggatgactataaagttggtt 10621075  T
323 gatgggtactccatgaatcatg 344  Q
    ||||||||||||||||||||||    
10621074 gatgggtactccatgaatcatg 10621053  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #12
Raw Score: 296; E-Value: 1e-166
Query Start/End: Original strand, 29 - 344
Target Start/End: Complemental strand, 10628447 - 10628132
Alignment:
29 aaagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatattaggagta 128  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
10628447 aaagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatattaggagta 10628348  T
129 atatttatattggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattccaccct 228  Q
    |||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||| |||||||||    
10628347 atatttatattggattgatccgccatgagaatactacatagtaaaagttatgaaaagtgtcataagatattctcatagtgataatggtgttttccaccct 10628248  T
229 tcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggttgatggg 328  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||    
10628247 tcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaactttgtccgtaacaggatgactataaagttggttgatggg 10628148  T
329 tactccatgaatcatg 344  Q
    ||||||||||||||||    
10628147 tactccatgaatcatg 10628132  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #13
Raw Score: 290; E-Value: 1e-163
Query Start/End: Original strand, 23 - 344
Target Start/End: Complemental strand, 28393175 - 28392854
Alignment:
23 atcatcaaagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatatta 122  Q
    ||||| ||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||    
28393175 atcattaaagcatagagactattatgtgggtagactgatgatcacatctcacatatcatggataaagagttatcaagtcttcacatagatataaatatta 28393076  T
123 ggagtaatatttatattggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattc 222  Q
    | |||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
28393075 gaagtaatatttatattggattgatccgccatgagaatactacatagtaaaagttatgaaaagtgtcataagatattctcatagtgatagtggtgtattc 28392976  T
223 cacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggtt 322  Q
    |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
28392975 cacccttcaacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggtt 28392876  T
323 gatgggtactccatgaatcatg 344  Q
    |||| |||||||||||||||||    
28392875 gatgagtactccatgaatcatg 28392854  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #14
Raw Score: 278; E-Value: 1e-155
Query Start/End: Original strand, 23 - 344
Target Start/End: Original strand, 8845369 - 8845690
Alignment:
23 atcatcaaagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatatta 122  Q
    ||||| ||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||| |||| | ||||||||||||||||    
8845369 atcattaaagcatagagactattatgtgggtaggctgatgatcacatctcacagatcatggataaagagttatcaattctttatatagatataaatatta 8845468  T
123 ggagtaatatttatattggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattc 222  Q
    |||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||    
8845469 ggagtaatatttatattggattgatccgccatgagaatactacatagtaaaagttatgaaaagtgtcataatatattctcatagtgatagtggtgtattc 8845568  T
223 cacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggtt 322  Q
    || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||    
8845569 catccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaatttggtt 8845668  T
323 gatgggtactccatgaatcatg 344  Q
    ||||||||||||||||||||||    
8845669 gatgggtactccatgaatcatg 8845690  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #15
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 23 - 344
Target Start/End: Complemental strand, 4426645 - 4426336
Alignment:
23 atcatcaaagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatatta 122  Q
    ||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4426645 atcattaaagcatagagactattatgtgggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatatta 4426546  T
123 ggagtaatatttatattggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattc 222  Q
    |||||||||||||||||||||||||||| |||||||||||||||||||||||  ||| |||||            |||||||||||||||||||||||||    
4426545 ggagtaatatttatattggattgatccgccatgagaatactacatagtaaaatctatgaaaag------------ttctcatagtgatagtggtgtattc 4426458  T
223 cacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggtt 322  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||| |||||||||||||||||||||    
4426457 cacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgttaccattcaaacattgtccgtaataggatgactataaagttggtt 4426358  T
323 gatgggtactccatgaatcatg 344  Q
    ||||||||||||||||||||||    
4426357 gatgggtactccatgaatcatg 4426336  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #16
Raw Score: 216; E-Value: 1e-118
Query Start/End: Original strand, 29 - 344
Target Start/End: Original strand, 35223732 - 35224047
Alignment:
29 aaagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatattaggagta 128  Q
    |||||||| |||||||||||| ||||||| |||||||||||||||| |||||| ||||||||||||||| ||||| |||||  |||||||||||||||||    
35223732 aaagcatatagactattatgtgggtagacggatgatcacatctcacggatcatagataaagagttatcatgtctttacatatgtataaatattaggagta 35223831  T
129 atatttatattggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattccaccct 228  Q
    ||||||||| |||||||| ||  ||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||    
35223832 atatttatactggattgaaccaccatgagaatactatatagtaaaagttatgaaaagtgtcataagatattctcatagtgatagtgttgtattccaccct 35223931  T
229 tcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggttgatggg 328  Q
    | ||||||||||||| ||||||| ||||||||||||||||||||||| ||| ||||||||||||||| |||||| ||||||||||||||||||||||| |    
35223932 ttgacctgaaaccacgatgtaccttagatgttggagtcgagtgctttatcaacattcaaacgttgtctgtaacaagatgactataaagttggttgatgtg 35224031  T
329 tactccatgaatcatg 344  Q
    ||||||| ||||||||    
35224032 tactccacgaatcatg 35224047  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #17
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 33 - 344
Target Start/End: Complemental strand, 5668156 - 5667849
Alignment:
33 catagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatattaggagtaatat 132  Q
    ||||||||||||||||| | ||||| ||||||||  |||||| |||||| |||||||||||||||  ||||||| ||| |||||||||||||||||||||    
5668156 catagagactattatgtggatagaccgatgatca--tctcacggatcatagataaagagttatcatatcttcacgtaggtataaatattaggagtaatat 5668059  T
133 ttatattggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattccacccttcga 232  Q
    ||||| ||||||||  |  |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||    
5668058 ttatactggattgactcaccatgagaatactacatagtaaaagttatgaaaagtgtcataagatattctcatagtgatagtggtgtattccacccttaga 5667959  T
233 cctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggttgatgggtact 332  Q
    |||||||||||||||||||||||||||||  |||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||    
5667958 cctgaaaccactatgtaccctagatgttg--gtcgagtgctttgtcaccattcaaacgttgtctgtaacaagatgactataaagttggttgatgggtact 5667861  T
333 ccatgaatcatg 344  Q
    ||| ||||||||    
5667860 ccacgaatcatg 5667849  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #18
Raw Score: 164; E-Value: 1e-87
Query Start/End: Original strand, 23 - 348
Target Start/End: Original strand, 20311458 - 20311781
Alignment:
23 atcatcaaagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatatta 122  Q
    ||||| ||||||||||||||||| ||| |||||| |||||||||||| |||  ||||||||||||||||||||||||||||||||||||| |||||||||    
20311458 atcattaaagcatagagactattttgtgggtagattgatgatcacatatcatggatcatggataaagagttatcaagtcttcacatagatgtaaatatta 20311557  T
123 ggagtaatatttatattggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgat-agtggtgtatt 221  Q
    |||||||| ||||||||||||||| | ||||||||||||||||||||  | ||||||   || | |||||   ||||||||||||||| |||||||||||    
20311558 ggagtaatttttatattggattgacctgtcatgagaatactacatag--acagttat-gtaactatcatacattattctcatagtgataagtggtgtatt 20311654  T
222 ccacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggt 321  Q
    ||||||||| || |||||||||||| |||||||||||| ||| |||||| ||||||  || | ||||||||||||||| ||||||||||||||||| |||    
20311655 ccacccttctacttgaaaccactatttaccctagatgtaggattcgagtactttgttcccgtacaaacgttgtccgtagcaggatgactataaagtcggt 20311754  T
322 tgatgggtactccatgaatcatgatga 348  Q
    | || ||||||||| ||||||||||||    
20311755 taatcggtactccacgaatcatgatga 20311781  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #19
Raw Score: 137; E-Value: 2e-71
Query Start/End: Original strand, 112 - 344
Target Start/End: Complemental strand, 10677534 - 10677303
Alignment:
112 tataaatattaggagtaatatttatattggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgata 211  Q
    |||||||||||||||||||||||||| |||||||| ||   ||||||||||||||||||||| ||||| |||| ||||||||||||||||||||||||||    
10677534 tataaatattaggagtaatatttatactggattgacccactatgagaatactacatagtaaatgttatgaaaaatgtcataagatattctcatagtgata 10677435  T
212 gtggtgtattccacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgacta 311  Q
    |||||||||| ||||||| ||| ||||||||||||||| ||||||||| |||||||||||||||  ||||||| |||||||||  |||| | |||||| |    
10677434 gtggtgtatttcaccctttgacttgaaaccactatgtatcctagatgtaggagtcgagtgctttaccaccatttaaacgttgtttgtaataagatgac-a 10677336  T
312 taaagttggttgatgggtactccatgaatcatg 344  Q
    |||||||||| ||||||||||||||||| ||||    
10677335 taaagttggtagatgggtactccatgaaccatg 10677303  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #20
Raw Score: 137; E-Value: 2e-71
Query Start/End: Original strand, 112 - 344
Target Start/End: Complemental strand, 10891174 - 10890943
Alignment:
112 tataaatattaggagtaatatttatattggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgata 211  Q
    |||||||||||||||||||||||||| |||||||| ||   ||||||||||||||||||||| ||||| |||| ||||||||||||||||||||||||||    
10891174 tataaatattaggagtaatatttatactggattgacccactatgagaatactacatagtaaatgttatgaaaaatgtcataagatattctcatagtgata 10891075  T
212 gtggtgtattccacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgacta 311  Q
    |||||||||| ||||||| ||| ||||||||||||||| ||||||||| |||||||||||||||  ||||||| |||||||||  |||| | |||||| |    
10891074 gtggtgtatttcaccctttgacttgaaaccactatgtatcctagatgtaggagtcgagtgctttaccaccatttaaacgttgtttgtaataagatgac-a 10890976  T
312 taaagttggttgatgggtactccatgaatcatg 344  Q
    |||||||||| ||||||||||||||||| ||||    
10890975 taaagttggtagatgggtactccatgaaccatg 10890943  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #21
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 37 - 344
Target Start/End: Original strand, 15461497 - 15461799
Alignment:
37 gagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatattaggagtaatatttat 136  Q
    |||||||||||||| |||||||||||| | |||||||  | |||| ||||  ||| ||||||||||  ||||||||||||||||||||||||||||||||    
15461497 gagactattatgtatgtagactgatgaccgcatctcatgggtcatagatat-gagatatcaagtctatacatagatataaatattaggagtaatatttat 15461595  T
137 attggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattccacccttcgacctg 236  Q
    |||||||||| ||  | |||||||||||||||||  |||||||  ||| |||||||||||||||||| | ||||| |  |||||  | | ||| ||||||    
15461596 attggattgacccaccgtgagaatactacatagt--aagttat-gaaattgtcataagatattctcacaatgataataatgtatatcgctcttagacctg 15461692  T
237 aaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggttgatgggtactccat 336  Q
    |||||||||||  ||||||||| |||| || ||||||||||  |||||| ||||||||| |||| ||||| |  |||| |||||||||||||||||  ||    
15461693 aaaccactatgatccctagatg-tggactcaagtgctttgttgccattctaacgttgtctgtaaaaggataatcataacgttggttgatgggtacttgat 15461791  T
337 gaatcatg 344  Q
    ||||||||    
15461792 gaatcatg 15461799  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #22
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 37 - 344
Target Start/End: Original strand, 34975551 - 34975853
Alignment:
37 gagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatattaggagtaatatttat 136  Q
    |||||||||||||| |||||||||||| | |||||||  | |||| ||||  ||| ||||||||||  ||||||||||||||||||||||||||||||||    
34975551 gagactattatgtatgtagactgatgaccgcatctcatgggtcatagatat-gagatatcaagtctatacatagatataaatattaggagtaatatttat 34975649  T
137 attggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattccacccttcgacctg 236  Q
    |||||||||| ||    |||||||||||||||||  |||||||  ||| |||||||||||||||||| | ||||| |  |||||  | | ||| ||||||    
34975650 attggattgacccactgtgagaatactacatagt--aagttat-gaaattgtcataagatattctcacaatgataataatgtatatcgctcttagacctg 34975746  T
237 aaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggttgatgggtactccat 336  Q
    |||||||||||  ||||||||| |||| || ||||||||||  |||||| ||||||||| |||| ||||| || |||| |||||||||||||||||  ||    
34975747 aaaccactatgatccctagatg-tggactcaagtgctttgtttccattctaacgttgtctgtaaaaggataaccataacgttggttgatgggtacttgat 34975845  T
337 gaatcatg 344  Q
    ||||||||    
34975846 gaatcatg 34975853  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #23
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 37 - 344
Target Start/End: Original strand, 2677013 - 2677315
Alignment:
37 gagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatattaggagtaatatttat 136  Q
    |||||||||||||| |||||||||||| | |||||||  | |||| ||||  ||| ||||||||||  ||||||||||||||||||||||||||||||||    
2677013 gagactattatgtatgtagactgatgaccgcatctcatgggtcatagatat-gagatatcaagtctatacatagatataaatattaggagtaatatttat 2677111  T
137 attggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattccacccttcgacctg 236  Q
    |||||||||| ||    |||||||||||||||||  |||||||  ||| |||||||||||||||||| | ||||| |  |||||  | | ||| ||||||    
2677112 attggattgacccactgtgagaatactacatagt--aagttat-gaaattgtcataagatattctcacaatgataataatgtatatcgctcttagacctg 2677208  T
237 aaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggttgatgggtactccat 336  Q
    |||||||||||  | ||||||| |||| || ||||||||||  |||||| ||||||||| |||| ||||| || |||| ||||||||||||| |||  ||    
2677209 aaaccactatgatctctagatg-tggactcaagtgctttgttgccattctaacgttgtctgtaaaaggataacaataacgttggttgatgggcacttgat 2677307  T
337 gaatcatg 344  Q
    ||||||||    
2677308 gaatcatg 2677315  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #24
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 37 - 344
Target Start/End: Original strand, 15815021 - 15815323
Alignment:
37 gagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatattaggagtaatatttat 136  Q
    |||||||||||||| |||||||||||| | |||||||  | |||| ||||  ||| ||||||||||  ||||||||||||||||||||||||||||||||    
15815021 gagactattatgtatgtagactgatgaccgcatctcatgggtcatagatat-gagatatcaagtctatacatagatataaatattaggagtaatatttat 15815119  T
137 attggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattccacccttcgacctg 236  Q
    |||||||||| ||    |||||||||||||||||  |||||||  ||| |||||||||||||||||| | ||||| |  |||||  | | ||| ||||||    
15815120 attggattgacccactgtgagaatactacatagt--aagttat-gaaattgtcataagatattctcacaatgataataatgtatatcgctcttagacctg 15815216  T
237 aaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggttgatgggtactccat 336  Q
    |||||||||||  | ||||||| |||| || ||||||||||  |||||| ||||||||| |||| ||||| || |||| ||||||||||||| |||  ||    
15815217 aaaccactatgatctctagatg-tggactcaagtgctttgttgccattctaacgttgtctgtaaaaggataacaataacgttggttgatgggcacttgat 15815315  T
337 gaatcatg 344  Q
    ||||||||    
15815316 gaatcatg 15815323  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #25
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 37 - 344
Target Start/End: Complemental strand, 18111345 - 18111043
Alignment:
37 gagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatattaggagtaatatttat 136  Q
    |||||||||||||| |||||||||||| | |||||||  | |||| ||||  ||| ||||||||||  ||||||||||||||||||||||||||||||||    
18111345 gagactattatgtatgtagactgatgaccgcatctcatgggtcatagatat-gagatatcaagtctatacatagatataaatattaggagtaatatttat 18111247  T
137 attggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattccacccttcgacctg 236  Q
    |||||||||| ||    |||||||||||||||||  |||||||  ||| |||||||||||||||||| | ||||| |  |||||  | | ||| ||||||    
18111246 attggattgacccactgtgagaatactacatagt--aagttat-gaaattgtcataagatattctcacaatgataataatgtatatcgctcttagacctg 18111150  T
237 aaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggttgatgggtactccat 336  Q
    |||||||||||  | ||||||| |||| || ||||||||||  |||||| ||||||||| |||| ||||| || |||| ||||||||||||| |||  ||    
18111149 aaaccactatgatctctagatg-tggactcaagtgctttgttgccattctaacgttgtctgtaaaaggataacaataacgttggttgatgggcacttgat 18111051  T
337 gaatcatg 344  Q
    ||||||||    
18111050 gaatcatg 18111043  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #26
Raw Score: 93; E-Value: 3e-45
Query Start/End: Original strand, 37 - 344
Target Start/End: Complemental strand, 3369325 - 3369023
Alignment:
37 gagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatattaggagtaatatttat 136  Q
    |||||||||||||| |||||||||||| | |||||||  | |||| ||||  ||| ||||||||||  |||||||||||||||||||||||||||||| |    
3369325 gagactattatgtatgtagactgatgaccgcatctcatgggtcatagatat-gagatatcaagtctatacatagatataaatattaggagtaatatttgt 3369227  T
137 attggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattccacccttcgacctg 236  Q
    |||||||||| ||    |||||||||||||||||  |||||||  ||| |||||||||||||||||| | ||||| |  |||||  | | ||| ||||||    
3369226 attggattgacccactgtgagaatactacatagt--aagttat-gaaattgtcataagatattctcacaatgataataatgtatatcgctcttagacctg 3369130  T
237 aaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggttgatgggtactccat 336  Q
    |||||||||||  | || |||| |||| || ||||||||||  |||||| ||||||||| |||| ||||| || |||| |||||||||||||||||  ||    
3369129 aaaccactatgatctcttgatg-tggactcaagtgctttgttgccattctaacgttgtctgtaaaaggataacaataacgttggttgatgggtacttgat 3369031  T
337 gaatcatg 344  Q
    ||||||||    
3369030 gaatcatg 3369023  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #27
Raw Score: 93; E-Value: 3e-45
Query Start/End: Original strand, 37 - 344
Target Start/End: Complemental strand, 17300261 - 17299959
Alignment:
37 gagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatattaggagtaatatttat 136  Q
    |||||||||||||| |||||||||||| | |||||||  | |||| ||||  ||| ||||||||||  ||||||||||||||||||||||||||||||||    
17300261 gagactattatgtatgtagactgatgaccgcatctcatgggtcatagatat-gagatatcaagtctatacatagatataaatattaggagtaatatttat 17300163  T
137 attggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattccacccttcgacctg 236  Q
    |||||||||| ||    |||||||||||||||||  |||||||  ||| |||||||||||||||||| | ||||| |  |||||  | | ||| ||||||    
17300162 attggattgacccactgtgagaatactacatagt--aagttat-gaaattgtcataagatattctcacaatgataataatgtatatcgctcttagacctg 17300066  T
237 aaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggttgatgggtactccat 336  Q
    |||||||||||  | ||||||| |||| || ||||||||||  |||||| ||||||||| |||| ||||| || |||| ||||||||||| | |||  ||    
17300065 aaaccactatgatctctagatg-tggactcaagtgctttgttgccattctaacgttgtctgtaaaaggataacaataacgttggttgatgagcacttgat 17299967  T
337 gaatcatg 344  Q
    ||||||||    
17299966 gaatcatg 17299959  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #28
Raw Score: 89; E-Value: 8e-43
Query Start/End: Original strand, 37 - 344
Target Start/End: Original strand, 18163162 - 18163464
Alignment:
37 gagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatattaggagtaatatttat 136  Q
    |||||||||||||| |||||||||||||| |||||||  | |||| ||||  ||| ||| ||||||  ||||||||||||||||||| ||||||||||||    
18163162 gagactattatgtatgtagactgatgatcgcatctcatgggtcatagatat-gagatattaagtctatacatagatataaatattagaagtaatatttat 18163260  T
137 attggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattccacccttcgacctg 236  Q
    |||||||| | ||    |||||||||||||||||  |||||||  ||| |||||||||||||||||| | ||||| |  |||||    | ||| ||||||    
18163261 attggattcacccactgtgagaatactacatagt--aagttat-gaaattgtcataagatattctcacaatgataataatgtatattgctcttagacctg 18163357  T
237 aaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggttgatgggtactccat 336  Q
    |||||||||||  | ||||||| |||| || ||||||||||  |||||| ||||||||| |||| ||||| || |||| |||||||||||||||||  ||    
18163358 aaaccactatgatctctagatg-tggactcaagtgctttgttgccattctaacgttgtctgtaaaaggataacaataacgttggttgatgggtacttgat 18163456  T
337 gaatcatg 344  Q
    ||||||||    
18163457 gaatcatg 18163464  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #29
Raw Score: 89; E-Value: 8e-43
Query Start/End: Original strand, 37 - 344
Target Start/End: Original strand, 20243937 - 20244239
Alignment:
37 gagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatattaggagtaatatttat 136  Q
    |||||||||||||| |||||||||||| | |||||||  | |||| ||||  ||| ||| ||||||  ||||||||||||||||||| ||||||||||||    
20243937 gagactattatgtatgtagactgatgaccgcatctcatgggtcatagatat-gagatattaagtctatacatagatataaatattagaagtaatatttat 20244035  T
137 attggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattccacccttcgacctg 236  Q
    |||||||||| ||    |||||||||||||||||  |||||||  ||| |||||||||||||||||| | ||||| |  |||||    | ||| ||||||    
20244036 attggattgacccactgtgagaatactacatagt--aagttat-gaaattgtcataagatattctcacaatgataataatgtatattgctcttagacctg 20244132  T
237 aaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggttgatgggtactccat 336  Q
    |||||||||||  | ||||||| |||| || ||||||||||  |||||| ||||||||| |||| ||||| || |||| |||||||||||||||||  ||    
20244133 aaaccactatgatctctagatg-tggactcaagtgctttgttgccattctaacgttgtctgtaaaaggataacaataacgttggttgatgggtacttgat 20244231  T
337 gaatcatg 344  Q
    ||||||||    
20244232 gaatcatg 20244239  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #30
Raw Score: 89; E-Value: 8e-43
Query Start/End: Original strand, 37 - 344
Target Start/End: Original strand, 26531613 - 26531915
Alignment:
37 gagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatattaggagtaatatttat 136  Q
    |||||||||||||| |||||||||||| | |||||||  | |||| ||||  ||| ||||||| ||  ||||| ||||||||||||||||||||||||||    
26531613 gagactattatgtatgtagactgatgaccgcatctcatgggtcatagatat-gagatatcaaggctatacataaatataaatattaggagtaatatttat 26531711  T
137 attggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattccacccttcgacctg 236  Q
    |||||||||| ||    |||||||||||||||||  |||||||  ||| |||||||||||||||||| | ||||| |  |||||  | | ||| ||||||    
26531712 attggattgacccactgtgagaatactacatagt--aagttat-gaaattgtcataagatattctcacaatgataataatgtatatcgctcttagacctg 26531808  T
237 aaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggttgatgggtactccat 336  Q
    |||||||||||  | ||||||| |||| || ||||||||||  |||||| ||||||||| |||| ||||| || |||| ||||||||||||| |||  ||    
26531809 aaaccactatgatctctagatg-tggactcaagtgctttgttgccattctaacgttgtctgtaaaaggataacaataacgttggttgatgggcacttgat 26531907  T
337 gaatcatg 344  Q
    ||||||||    
26531908 gaatcatg 26531915  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #31
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 37 - 344
Target Start/End: Complemental strand, 4676285 - 4675983
Alignment:
37 gagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatattaggagtaatatttat 136  Q
    |||||||||||||| |||||||||||| | |||||||  | |||| ||||  ||| ||| ||||||  ||||||||||||||||||| ||||||||||||    
4676285 gagactattatgtatgtagactgatgaccgcatctcatgggtcatagatat-gagatattaagtctatacatagatataaatattagaagtaatatttat 4676187  T
137 attggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattccacccttcgacctg 236  Q
    |||||||||| ||    |||||||||||||||||  |||||||  ||| |||||||||||||||||| | ||||| |  |||||    | ||| ||||||    
4676186 attggattgacccactgtgagaatactacatagt--aagttat-gaaattgtcataagatattctcacaatgataataatgtatattgctcttagacctg 4676090  T
237 aaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggttgatgggtactccat 336  Q
    |||||||||||  | ||||||| |||| || ||||||||||  |||||  ||||||||| |||| ||||| || |||| |||||||||||||||||  ||    
4676089 aaaccactatgatctctagatg-tggactcaagtgctttgttgccattataacgttgtctgtaaaaggataacaataacgttggttgatgggtacttgat 4675991  T
337 gaatcatg 344  Q
    ||||||||    
4675990 gaatcatg 4675983  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #32
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 33 - 169
Target Start/End: Original strand, 56516232 - 56516368
Alignment:
33 catagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatattaggagtaatat 132  Q
    |||||||||||||||||||||||| | ||||||| ||||||||||| ||||||||||||||||||||||||||||||  ||||||||| | |||||||||    
56516232 catagagactattatgtaggtagattaatgatcaaatctcacagataatggataaagagttatcaagtcttcacatacgtataaatatcatgagtaatat 56516331  T
133 ttatattggattgatccgtcatgagaatactacatag 169  Q
    ||||||||||||||  ||  ||||||| |||||||||    
56516332 ttatattggattgactcgctatgagaacactacatag 56516368  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #33
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 38 - 344
Target Start/End: Original strand, 5870419 - 5870720
Alignment:
38 agactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatattaggagtaatatttata 137  Q
    ||||||||||||| |||||||||||| | |||||||  | |||| ||||  ||| ||||||||||  |||||||||||||||||||||||||||||||||    
5870419 agactattatgtatgtagactgatgaccgcatctcatgggtcatagatat-gagatatcaagtctatacatagatataaatattaggagtaatatttata 5870517  T
138 ttggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattccacccttcgacctga 237  Q
    ||||||||| ||    |||||||||||||||||  |||||||  ||| ||||||| |||||||||| | ||||| |  |||||  | | ||| |||||||    
5870518 ttggattgacccactgtgagaatactacatagt--aagttat-gaaattgtcatatgatattctcacaatgataataatgtatatcgctcttagacctga 5870614  T
238 aaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggttgatgggtactccatg 337  Q
    ||||||||||  | ||||||| |||| || |||| |||||   ||||| |||||||||  ||| ||||| || |||| ||||||||||| |||||  |||    
5870615 aaccactatgatctctagatg-tggactcaagtgttttgttgtcattctaacgttgtctataataggataacaataacgttggttgatgagtacttgatg 5870713  T
338 aatcatg 344  Q
    |||||||    
5870714 aatcatg 5870720  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #34
Raw Score: 79; E-Value: 7e-37
Query Start/End: Original strand, 93 - 243
Target Start/End: Complemental strand, 21454110 - 21453961
Alignment:
93 tatcaagtcttcacatagatataaatattaggagtaatatttatattggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcata 192  Q
    |||||||| |||||||| |||||||||||||||||||||||||||||| ||||| ||  ||||||||||||||||| ||  ||||||  ||| | |||||    
21454110 tatcaagttttcacatacatataaatattaggagtaatatttatattgaattgacccaccatgagaatactacata-tatgagttatgtaaaatatcata 21454012  T
193 agatattctcatagtgatagtggtgtattccacccttcgacctgaaaccac 243  Q
    ||||||| |||| |||||||||||||||  |||||||||||||||||||||    
21454011 agatattttcattgtgatagtggtgtatgtcacccttcgacctgaaaccac 21453961  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #35
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 37 - 328
Target Start/End: Original strand, 19365519 - 19365806
Alignment:
37 gagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatattaggagtaatatttat 136  Q
    ||||||||||| || |||||||||||| |||||||||  | |||||  ||  ||| ||| || |||  |||||| |||||||||||||||||||||||||    
19365519 gagactattatatacgtagactgatgaccacatctcatgggtcatgagtat-gagatattaaatctatacataggtataaatattaggagtaatatttat 19365617  T
137 attggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctca-tagtgatagtggtgtattccacccttcgacct 235  Q
    | |||||||| ||  | ||||| |||||||||||  | |||||  ||||||||||||||||||||||  | ||||| |||||||| |||| ||| |||||    
19365618 actggattgacccaccgtgagagtactacatagt--atgttat-gaaagtgtcataagatattctcaccaatgataatggtgtataccactcttagacct 19365714  T
236 gaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggttgatggg 328  Q
    ||||||| ||||  ||||||||| |||| || |||||||| |   ||||||||||||||| ||||||||||||| |||| ||| ||| |||||    
19365715 gaaaccattatgatccctagatg-tggactcaagtgctttattgtcattcaaacgttgtctgtaacaggatgaccataacgttagttaatggg 19365806  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #36
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 37 - 344
Target Start/End: Original strand, 1941724 - 1942026
Alignment:
37 gagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatattaggagtaatatttat 136  Q
    ||||||||||||||  ||||||||||| | |||||||  | | || ||||  ||| ||| ||||||  |||||| |||||||||||||||||||||||||    
1941724 gagactattatgtatatagactgatgaccgcatctcatgggttatagatat-gagatattaagtctatacataggtataaatattaggagtaatatttat 1941822  T
137 attggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattccacccttcgacctg 236  Q
    |||||||| | ||  | |||||||||||||||||||  ||||| | |  |||||| ||||||||||| | ||||| | ||||||  | | ||| ||||||    
1941823 attggattaacccaccgtgagaatactacatagtaa--gttatgagat-tgtcatgagatattctcacaatgataatagtgtatatcgctcttagacctg 1941919  T
237 aaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggttgatgggtactccat 336  Q
    |||||||||||  |||||||||| ||| || ||| ||||||  |||||| || |||||| |||| ||||| || |||| |||||||||||||||||  ||    
1941920 aaaccactatgatccctagatgt-ggactcaagtactttgttgccattctaatgttgtctgtaaaaggataaccataacgttggttgatgggtacttgat 1942018  T
337 gaatcatg 344  Q
    ||||||||    
1942019 gaatcatg 1942026  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #37
Raw Score: 69; E-Value: 7e-31
Query Start/End: Original strand, 58 - 344
Target Start/End: Complemental strand, 32646807 - 32646523
Alignment:
58 tgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatattaggagtaatatttatattggattgatccgtcatgag 157  Q
    ||||||||||||||||| |||||| |||||||   |||| |||||||||||||||||||||||||||| ||||||||| |||||||||| |   ||| ||    
32646807 tgatgatcacatctcacggatcattgataaaggaatatcgagtcttcacatagatataaatattaggaataatatttacattggattgacctaccataag 32646708  T
158 aatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgat-agtggtgtattccacccttcgacctgaaaccactatgtaccctaga 256  Q
    ||| |||||||  ||| |||||  | |  |||| | || |||| | ||||||| |||||||||||  ||||||||||||||||| ||| |||| ||| ||    
32646707 aatgctacata--aaaggttatgtata-agtcacatgacattcccgtagtgataagtggtgtattttacccttcgacctgaaacaactctgtatcctgga 32646611  T
257 tgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggttgatgggtactccatgaatcatg 344  Q
    |||  |||||| || ||||||   | | |||||||  ||| ||||||||||| ||| |||| |||||||||||||   ||||||||||    
32646610 tgtatgagtcgggtactttgttgtcgtacaaacgtcatccataacaggatgattatgaagtcggttgatgggtaccggatgaatcatg 32646523  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #38
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 105 - 327
Target Start/End: Original strand, 19362477 - 19362695
Alignment:
105 acatagatataaatattaggagtaatatttatattggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcat 204  Q
    |||||| ||| |||||||||||||||||||||| |||||||| || || ||||| |||||||||||  | |||||  ||||||||||||||||||||||     
19362477 acataggtattaatattaggagtaatatttatactggattgacccatcgtgagagtactacatagt--atgttat-caaagtgtcataagatattctcac 19362573  T
205 agtgatagtggtgtattccacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacagg 304  Q
    | ||||| |||||||| |||| |||  ||||||||||||||||  || |||||| |||| |  | |||||| |   ||||||||||||||| ||||||||    
19362574 aatgataatggtgtataccactcttaaacctgaaaccactatgatccttagatg-tggacttaaatgctttattgtcattcaaacgttgtctgtaacagg 19362672  T
305 atgactataaagttggttgatgg 327  Q
    ||||| |||| | ||||| ||||    
19362673 atgaccataacggtggttaatgg 19362695  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #39
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 112 - 344
Target Start/End: Original strand, 9487625 - 9487853
Alignment:
112 tataaatattaggagtaatatttatattggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgata 211  Q
    |||||||||||||||||||||||||| ||||| || || || |||||||||||||||||  |||||||  | | |||||||||||||||||| | |||||    
9487625 tataaatattaggagtaatatttatactggatagacccatcgtgagaatactacatagt--aagttat-gagattgtcataagatattctcacaatgata 9487721  T
212 gtggtgtattccacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgacta 311  Q
     | ||||||  | | ||| |||||||||||||||||  ||||||||| |||| || |||  |||||   ||||  ||||||||| |||| ||||| || |    
9487722 atagtgtatatcgctcttagacctgaaaccactatgatccctagatg-tggactcaagtattttgttgtcattataacgttgtctgtaataggataacca 9487820  T
312 taaagttggttgatgggtactccatgaatcatg 344  Q
    |||  ||||||||||||||||  ||||||||||    
9487821 taacattggttgatgggtacttgatgaatcatg 9487853  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #40
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 37 - 242
Target Start/End: Original strand, 32636484 - 32636685
Alignment:
37 gagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatattaggagtaatatttat 136  Q
    |||||||||||||| |||||||||||| | |||||||  | ||||| |||  ||| ||| |||||    ||||| ||||||||||| |||||||||||||    
32636484 gagactattatgtatgtagactgatgaccgcatctcatgggtcatgaatac-gagatattaagtccatgcataggtataaatattatgagtaatatttat 32636582  T
137 attggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattccacccttcgacctg 236  Q
    |||||||||| ||    |||||||||||||||||  |||||||  ||| |||||||||||||||||| | ||||| |||||||| |||| || |||| ||    
32636583 attggattgacccaatgtgagaatactacatagt--aagttat-gaaattgtcataagatattctcacaatgataatggtgtataccactctccgacgtg 32636679  T
237 aaacca 242  Q
    ||||||    
32636680 aaacca 32636685  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #41
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 105 - 328
Target Start/End: Complemental strand, 5528714 - 5528495
Alignment:
105 acatagatataaatattaggagtaatatttatattggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcat 204  Q
    |||||| |||||||||||||||| |||||||||||| ||| | ||  | ||||||||| || ||||| |  |||| |||| || ||||||||||||||||    
5528714 acataggtataaatattaggagtgatatttatattgtattaacccaacgtgagaataccacgtagtata--ttatgaaaa-tgccataagatattctcat 5528618  T
205 agtgatagtggtgtattccacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacagg 304  Q
    | ||||| ||||||||  ||| |||  |||||||||  |||||  ||||||||| |||| || |||||||| |  ||||||||||||| || ||||||||    
5528617 aatgataatggtgtataacactcttatacctgaaactgctatgatccctagatg-tggactcaagtgctttatttccattcaaacgttatctgtaacagg 5528519  T
305 atgactataaagttggttgatggg 328  Q
    || || |||| ||||||| |||||    
5528518 ataaccataatgttggttaatggg 5528495  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #42
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 29 - 328
Target Start/End: Original strand, 5616387 - 5616681
Alignment:
29 aaagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatattaggagta 128  Q
    ||||||| |||||||||||||| ||||| |||||| |||||||||  | ||||  |||  ||| | | |||| |  || ||| |||||||||||| ||||    
5616387 aaagcattgagactattatgtatgtagattgatgaccacatctcatgggtcataaatat-gagatgttaagtatatacgtaggtataaatattagaagta 5616485  T
129 atatttatattggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattccaccct 228  Q
    ||||||||| |||||||| |   | ||||||||||||| |||  |  |||| ||| ||||||||||||||||| | | ||||| |||||||| |||  ||    
5616486 atatttatactggattgaccaaccgtgagaatactacagagttta--ttatgaaa-gtgtcataagatattcttacaatgataatggtgtataccaatct 5616582  T
229 tcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggttgatggg 328  Q
    | || ||||||||||||||  ||||||||| |||| || |||||||| |  |||||||||||||||  |||||| ||| ||| ||| ||||||| |||||    
5616583 tagatctgaaaccactatgatccctagatg-tggactcaagtgctttattgccattcaaacgttgtttgtaacaagataactgtaacgttggttaatggg 5616681  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #43
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 41 - 119
Target Start/End: Original strand, 24700213 - 24700291
Alignment:
41 ctattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaata 119  Q
    ||||||||| ||||||||||| ||||||||| ||||||| ||||||||||| ||| |||||||||||||||||||||||    
24700213 ctattatgtgggtagactgataatcacatcttacagatcttggataaagagatattaagtcttcacatagatataaata 24700291  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #44
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 124 - 344
Target Start/End: Complemental strand, 30040705 - 30040489
Alignment:
124 gagtaatatttatattggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattcc 223  Q
    |||||||||||||| | |||||| ||  ||||||| ||||||||||||   ||||| |||| |||||||||||||||||| | ||||| | ||||||  |    
30040705 gagtaatatttatactagattgacccaccatgagagtactacatagtat--gttatgaaaa-tgtcataagatattctcacaatgataatagtgtatatc 30040609  T
224 acccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggttg 323  Q
    || ||| |||||||||||||||||  ||||||||| |||| || ||||||||||   ||||| || |||||  |||| ||||| || |||| |||||||     
30040608 actcttagacctgaaaccactatgatccctagatg-tggactcaagtgctttgttgtcattctaatgttgtttgtaaaaggataaccataacgttggtta 30040510  T
324 atgggtactccatgaatcatg 344  Q
    ||| |||||  ||||||||||    
30040509 atgagtacttgatgaatcatg 30040489  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #45
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 112 - 328
Target Start/End: Original strand, 9538033 - 9538244
Alignment:
112 tataaatattaggagtaatatttatattggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgata 211  Q
    ||||||| |||||||||||||||||| |||||||| ||  | ||||||||||||||||   | |||||  |||||||||||||||||||||| | |||||    
9538033 tataaatgttaggagtaatatttatactggattgacccagcgtgagaatactacatag--catgttat-gaaagtgtcataagatattctcacaatgata 9538129  T
212 gtggtgtattccacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgacta 311  Q
     ||| ||  ||||  ||| ||||| ||||||| |||  || | |||| |||| || |||||||| |  |||||||||| |||||||||||||||| || |    
9538130 atggcgt-gtccagtcttagacctcaaaccaccatgatccttggatg-tggactcaagtgctttattgccattcaaacattgtccgtaacaggataacca 9538227  T
312 taaagttggttgatggg 328  Q
    ||| ||||||| |||||    
9538228 taacgttggttaatggg 9538244  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #46
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 37 - 259
Target Start/End: Original strand, 4546080 - 4546298
Alignment:
37 gagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatattaggagtaatatttat 136  Q
    |||||||||||||| || ||||||| ||| |||||||  | | || ||||  ||| ||| ||||||  |||||| |||||||||||||||||||||||||    
4546080 gagactattatgtatgttgactgataatcgcatctcatgggttatagatat-gagatattaagtctatacataggtataaatattaggagtaatatttat 4546178  T
137 attggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattccacccttcgacctg 236  Q
    | ||||  || ||  | |||||||||||||||||  |||||||  | | |||||||||||||||||| | ||||| | ||||||  | | ||| |||||     
4546179 actggacagacccaccgtgagaatactacatagt--aagttat-gagattgtcataagatattctcacaatgataatagtgtatatcgctctttgaccta 4546275  T
237 aaaccactatgtaccctagatgt 259  Q
    |||||||||||  ||||||||||    
4546276 aaaccactatgatccctagatgt 4546298  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #47
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 127 - 344
Target Start/End: Original strand, 11421096 - 11421309
Alignment:
127 taatatttatattggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattccacc 226  Q
    |||||||||||||||||||| ||  | | |||||||||||||||  | ||||| |||| |||||||||||||| ||| || |||| |  |||||  |||     
11421096 taatatttatattggattgacccaccgttagaatactacatagt--atgttatgaaaa-tgtcataagatattatcacagggataataatgtatatcact 11421192  T
227 cttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggttgatg 326  Q
    | | |||||||||||||||||  || |||||| || | || |||||||| |   ||||| ||||||||| |||| ||||| || |||| ||||| | |||    
11421193 catagacctgaaaccactatgatccgtagatg-tgtactcaagtgctttattgtcattctaacgttgtctgtaaaaggataaccataatgttggctaatg 11421291  T
327 ggtactccatgaatcatg 344  Q
    ||||||| ||||||||||    
11421292 ggtactcgatgaatcatg 11421309  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #48
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 216 - 266
Target Start/End: Original strand, 24701361 - 24701411
Alignment:
216 tgtattccacccttcgacctgaaaccactatgtaccctagatgttggagtc 266  Q
    |||||||||||||||||||| |||||||| |||||||||||||| ||||||    
24701361 tgtattccacccttcgacctaaaaccactgtgtaccctagatgtaggagtc 24701411  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #49
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 93 - 247
Target Start/End: Original strand, 33888594 - 33888743
Alignment:
93 tatcaagtcttcacatagatataaatattaggagtaatatttatattggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcata 192  Q
    |||||||| ||||||||||||||||||||| | ||||||||||   || ||||| ||  ||||| ||||| |||||  |  | ||||  ||||||| |||    
33888594 tatcaagttttcacatagatataaatattatgtgtaatattta---tgaattgacccaccatgataataccacata--atgatttatgtaaagtgtgata 33888688  T
193 agatattctcatagtgatagtggtgtattccacccttcgacctgaaaccactatg 247  Q
    ||||| | ||||| ||| |||||||||| ||||  |||||||||||| |||||||    
33888689 agataatatcatattgacagtggtgtatgccacatttcgacctgaaatcactatg 33888743  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #50
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 29 - 81
Target Start/End: Complemental strand, 10677590 - 10677538
Alignment:
29 aaagcatagagactattatgtaggtagactgatgatcacatctcacagatcat 81  Q
    |||| ||| |||||||||||| |||||||||||||||||||||||| ||||||    
10677590 aaagtatatagactattatgtgggtagactgatgatcacatctcacggatcat 10677538  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #51
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 29 - 81
Target Start/End: Complemental strand, 10891230 - 10891178
Alignment:
29 aaagcatagagactattatgtaggtagactgatgatcacatctcacagatcat 81  Q
    |||| ||| |||||||||||| |||||||||||||||||||||||| ||||||    
10891230 aaagtatatagactattatgtgggtagactgatgatcacatctcacggatcat 10891178  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #52
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 84 - 211
Target Start/End: Complemental strand, 34777975 - 34777850
Alignment:
84 ataaagagttatcaagtcttcacatagatataaatattaggagtaatatttatattggattgatccgtcatgagaatactacatagtaaaagttataaaa 183  Q
    ||||| |||||||||||||||| |||  ||||||||| | ||||||| ||| |||| |||||| ||  ||||||||||||||| | |   | ||||  ||    
34777975 ataaaaagttatcaagtcttcaaatatgtataaatataatgagtaatttttgtattagattgaccctccatgagaatactacacatt--gacttatgtaa 34777878  T
184 agtgtcataagatattctcatagtgata 211  Q
    |||||||||||||||| | |||||||||    
34777877 agtgtcataagatattttgatagtgata 34777850  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #53
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 25 - 95
Target Start/End: Complemental strand, 9938003 - 9937933
Alignment:
25 catcaaagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttat 95  Q
    |||| ||||||| |||||||| ||| |||||| | |||||||||||||| | |||||| ||||||||||||    
9938003 catcgaagcatatagactattgtgtgggtagagtcatgatcacatctcataaatcatgaataaagagttat 9937933  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #54
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 235 - 316
Target Start/End: Complemental strand, 9937826 - 9937745
Alignment:
235 tgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaag 316  Q
    ||||| |||||||||||||||||||  ||||||| | |||| ||  | ||||||| |||| ||||| |||||||||||||||    
9937826 tgaaatcactatgtaccctagatgtaagagtcgaatactttatcgtcgttcaaacattgttcgtaaaaggatgactataaag 9937745  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #55
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 114 - 205
Target Start/End: Complemental strand, 9937923 - 9937830
Alignment:
114 taaatattaggagtaatatttatattggattgatccgtcatgagaatactaca---tagtaaaagttataaaaagtgtcataagatattctcata 205  Q
    |||||| ||| |||||||||||||||| | ||| ||||||||||||||||||    |||||  | |||| ||| ||| |||||||||||||||||    
9937923 taaataatagaagtaatatttatattgcagtga-ccgtcatgagaatactactacttagtatgaattatgaaatgtgccataagatattctcata 9937830  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #56
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 37 - 73
Target Start/End: Original strand, 11421016 - 11421052
Alignment:
37 gagactattatgtaggtagactgatgatcacatctca 73  Q
    |||||||||||||| |||||||||||| |||||||||    
11421016 gagactattatgtatgtagactgatgaccacatctca 11421052  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #57
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 29 - 73
Target Start/End: Complemental strand, 30040784 - 30040740
Alignment:
29 aaagcatagagactattatgtaggtagactgatgatcacatctca 73  Q
    ||||||| ||||||||||||||  ||||||||||| |||||||||    
30040784 aaagcatcgagactattatgtatatagactgatgaccacatctca 30040740  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 310; Significance: 1e-174; HSPs: 46)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 310; E-Value: 1e-174
Query Start/End: Original strand, 23 - 344
Target Start/End: Original strand, 6110230 - 6110551
Alignment:
23 atcatcaaagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatatta 122  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6110230 atcattaaagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatatta 6110329  T
123 ggagtaatatttatattggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattc 222  Q
    |||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
6110330 ggagtaatatttatattggattgatccgccatgagaatactacatagtaaaagttatgaaaagtgtcataagatattctcatagtgatagtggtgtattc 6110429  T
223 cacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggtt 322  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6110430 cacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggtt 6110529  T
323 gatgggtactccatgaatcatg 344  Q
    ||||||||||||||||||||||    
6110530 gatgggtactccatgaatcatg 6110551  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 310; E-Value: 1e-174
Query Start/End: Original strand, 23 - 344
Target Start/End: Complemental strand, 16482524 - 16482203
Alignment:
23 atcatcaaagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatatta 122  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
16482524 atcattaaagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatatta 16482425  T
123 ggagtaatatttatattggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattc 222  Q
    |||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
16482424 ggagtaatatttatattggattgatccgccatgagaatactacatagtaaaagttatgaaaagtgtcataagatattctcatagtgatagtggtgtattc 16482325  T
223 cacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggtt 322  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
16482324 cacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggtt 16482225  T
323 gatgggtactccatgaatcatg 344  Q
    ||||||||||||||||||||||    
16482224 gatgggtactccatgaatcatg 16482203  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 306; E-Value: 1e-172
Query Start/End: Original strand, 23 - 344
Target Start/End: Complemental strand, 10579396 - 10579075
Alignment:
23 atcatcaaagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatatta 122  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
10579396 atcattaaagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatatta 10579297  T
123 ggagtaatatttatattggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattc 222  Q
    |||||||||||||||||||||||||||| ||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||    
10579296 ggagtaatatttatattggattgatccgccatgagaatactacataataaaagttatgaaaagtgtcataagatattctcatagtgatagtggtgtattc 10579197  T
223 cacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggtt 322  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
10579196 cacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggtt 10579097  T
323 gatgggtactccatgaatcatg 344  Q
    ||||||||||||||||||||||    
10579096 gatgggtactccatgaatcatg 10579075  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 306; E-Value: 1e-172
Query Start/End: Original strand, 23 - 344
Target Start/End: Complemental strand, 15600925 - 15600604
Alignment:
23 atcatcaaagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatatta 122  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
15600925 atcattaaagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatatta 15600826  T
123 ggagtaatatttatattggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattc 222  Q
    |||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
15600825 ggagtaatatttatattggattgatccgccatgagaatactacatagtaaaagttatgaaaagtgtcataagatattctcatagtgatagtggtgtattc 15600726  T
223 cacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggtt 322  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
15600725 cacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggtt 15600626  T
323 gatgggtactccatgaatcatg 344  Q
    ||||||||| ||||||||||||    
15600625 gatgggtaccccatgaatcatg 15600604  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 306; E-Value: 1e-172
Query Start/End: Original strand, 23 - 344
Target Start/End: Complemental strand, 15607470 - 15607149
Alignment:
23 atcatcaaagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatatta 122  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
15607470 atcattaaagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatatta 15607371  T
123 ggagtaatatttatattggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattc 222  Q
    |||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
15607370 ggagtaatatttatattggattgatccgccatgagaatactacatagtaaaagttatgaaaagtgtcataagatattctcatagtgatagtggtgtattc 15607271  T
223 cacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggtt 322  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
15607270 cacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggtt 15607171  T
323 gatgggtactccatgaatcatg 344  Q
    ||||||||| ||||||||||||    
15607170 gatgggtaccccatgaatcatg 15607149  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 302; E-Value: 1e-170
Query Start/End: Original strand, 23 - 344
Target Start/End: Complemental strand, 10572633 - 10572312
Alignment:
23 atcatcaaagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatatta 122  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
10572633 atcattaaagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatatta 10572534  T
123 ggagtaatatttatattggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattc 222  Q
    |||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||    
10572533 ggagtaatatttatattggattgatccgccatgagaatactacatagtaaaagttatgaaaactgtcataagatattctcatagtgatagtggtgtattc 10572434  T
223 cacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggtt 322  Q
    ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
10572433 cacccttcgacctgaaaccactatgtaccgtagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggtt 10572334  T
323 gatgggtactccatgaatcatg 344  Q
    ||||||||||||||||||||||    
10572333 gatgggtactccatgaatcatg 10572312  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 298; E-Value: 1e-167
Query Start/End: Original strand, 23 - 344
Target Start/End: Complemental strand, 15342260 - 15341939
Alignment:
23 atcatcaaagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatatta 122  Q
    ||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||    
15342260 atcattaaaacatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatctagtcttcacatagatataaaaatta 15342161  T
123 ggagtaatatttatattggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattc 222  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||    
15342160 ggagtaatatttatattggattgatccgtcatgagaatactacatagtaaaaattatgaaaagtgtcataagatattctcatagtgatagtggtgtattc 15342061  T
223 cacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggtt 322  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
15342060 cacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggtt 15341961  T
323 gatgggtactccatgaatcatg 344  Q
    ||||||||||||||||||||||    
15341960 gatgggtactccatgaatcatg 15341939  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 298; E-Value: 1e-167
Query Start/End: Original strand, 23 - 344
Target Start/End: Original strand, 18520141 - 18520462
Alignment:
23 atcatcaaagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatatta 122  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
18520141 atcattaaagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatatta 18520240  T
123 ggagtaatatttatattggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattc 222  Q
    ||||||||||||||||| |||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
18520241 ggagtaatatttatatttgattgatccgccatgagaatactacatagtaaaagttatgaaaagtgtcataagatattctcatagtgatagtggtgtattc 18520340  T
223 cacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggtt 322  Q
    |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||    
18520341 cacccttcgaactgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccataacaggatgactataaagttggtt 18520440  T
323 gatgggtactccatgaatcatg 344  Q
    ||||||||||||||||||||||    
18520441 gatgggtactccatgaatcatg 18520462  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 295; E-Value: 1e-166
Query Start/End: Original strand, 38 - 344
Target Start/End: Original strand, 8490676 - 8490982
Alignment:
38 agactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatattaggagtaatatttata 137  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8490676 agacgattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatattaggagtaatatttata 8490775  T
138 ttggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattccacccttcgacctga 237  Q
    ||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8490776 ttggattgatccgccatgagaatactacatagtaaaagttatgaaaagtgtcataagatattctcatagtgatagtggtgtattccacccttcgacctga 8490875  T
238 aaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggttgatgggtactccatg 337  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8490876 aaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggttgatgggtactccatg 8490975  T
338 aatcatg 344  Q
    |||||||    
8490976 aatcatg 8490982  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #10
Raw Score: 295; E-Value: 1e-166
Query Start/End: Original strand, 30 - 340
Target Start/End: Original strand, 18522836 - 18523146
Alignment:
30 aagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatattaggagtaa 129  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
18522836 aagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatattaggagtaa 18522935  T
130 tatttatattggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattccaccctt 229  Q
    ||||||||||||||||||||| ||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||    
18522936 tatttatattggattgatccgccatgaaaatactacatagtaaaagttatgaaaagtgtcataagatattctcatagtgatagtggtgtatttcaccctt 18523035  T
230 cgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggttgatgggt 329  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
18523036 cgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggttgatgggt 18523135  T
330 actccatgaat 340  Q
    |||||||||||    
18523136 actccatgaat 18523146  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #11
Raw Score: 294; E-Value: 1e-165
Query Start/End: Original strand, 23 - 344
Target Start/End: Complemental strand, 15357627 - 15357306
Alignment:
23 atcatcaaagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatatta 122  Q
    ||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||    
15357627 atcattaaaacatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatctagtcttcacatagatataaaaatta 15357528  T
123 ggagtaatatttatattggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattc 222  Q
    ||||||||||||||||||| |||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
15357527 ggagtaatatttatattgggttgatccgccatgagaatactacatagtaaaagttatgaaaagtgtcataagatattctcatagtgatagtggtgtattc 15357428  T
223 cacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggtt 322  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
15357427 cacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggtt 15357328  T
323 gatgggtactccatgaatcatg 344  Q
    ||||||||||||||||||||||    
15357327 gatgggtactccatgaatcatg 15357306  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #12
Raw Score: 294; E-Value: 1e-165
Query Start/End: Original strand, 23 - 344
Target Start/End: Complemental strand, 17781159 - 17780838
Alignment:
23 atcatcaaagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatatta 122  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||    
17781159 atcattaaagcatagagactattatgtaggtagactgatgatcacatctcacaaatcatagataaagagttatcaagtcttcacatagatataaatatta 17781060  T
123 ggagtaatatttatattggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattc 222  Q
    |||||||||||||||||||||||||||| ||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||    
17781059 ggagtaatatttatattggattgatccgccatgagaatactacatagtaaaaattatgaaaagtgtcataagatattctcatagtgatagtggtgtattc 17780960  T
223 cacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggtt 322  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||    
17780959 cacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaataggatgactataaagttggtt 17780860  T
323 gatgggtactccatgaatcatg 344  Q
    ||||||||||||||||||||||    
17780859 gatgggtactccatgaatcatg 17780838  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #13
Raw Score: 290; E-Value: 1e-163
Query Start/End: Original strand, 23 - 344
Target Start/End: Original strand, 13211468 - 13211789
Alignment:
23 atcatcaaagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatatta 122  Q
    ||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||    
13211468 atcattaaagcatagagactattatgtaggtagactgatgatcacaactcacagatcatggataaagagttatcaagtcttcacatagatataaatatta 13211567  T
123 ggagtaatatttatattggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattc 222  Q
    |||||||||||||||||||||||||||| |||||||||| ||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||    
13211568 ggagtaatatttatattggattgatccgccatgagaatattacatagtaaaagttatgaaaagtgtcataatatattctcatagtgatagtggtgtattc 13211667  T
223 cacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggtt 322  Q
    |||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
13211668 cacccttcgacctgaaaccattatgtaacctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggtt 13211767  T
323 gatgggtactccatgaatcatg 344  Q
    ||||||||||||||||||||||    
13211768 gatgggtactccatgaatcatg 13211789  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #14
Raw Score: 288; E-Value: 1e-161
Query Start/End: Original strand, 29 - 344
Target Start/End: Original strand, 13248779 - 13249094
Alignment:
29 aaagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatattaggagta 128  Q
    |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
13248779 aaagcatagagactattatgtaggtagactgatgatcacaactcacagatcatggataaagagttatcaagtcttcacatagatataaatattaggagta 13248878  T
129 atatttatattggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattccaccct 228  Q
    ||||||||||||||||||| || |||||||||| ||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||    
13248879 atatttatattggattgattcgccatgagaatattacatagtaaaagttatgaaaagtgtcataatatattctcatagtgatagtggtgtattccaccct 13248978  T
229 tcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggttgatggg 328  Q
    ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
13248979 tcgacctgaaaccactatgtaacctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggttgatggg 13249078  T
329 tactccatgaatcatg 344  Q
    ||||||||||||||||    
13249079 tactccatgaatcatg 13249094  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #15
Raw Score: 283; E-Value: 1e-158
Query Start/End: Original strand, 23 - 344
Target Start/End: Complemental strand, 32056941 - 32056619
Alignment:
23 atcatcaaagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaa-tatt 121  Q
    ||||| ||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||    
32056941 atcattaaagcatagagactattatgtgggtagactaatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaaatatt 32056842  T
122 aggagtaatatttatattggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtatt 221  Q
    | ||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||    
32056841 atgagtaatatttatattggattgatccgccatgagaatactacatagtaaaagttatgaaaagtgtcataagatattctcatagtgatagtggtgtatt 32056742  T
222 ccacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggt 321  Q
    ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32056741 ccacccttcaacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggt 32056642  T
322 tgatgggtactccatgaatcatg 344  Q
    |||||| ||||||||||||||||    
32056641 tgatggatactccatgaatcatg 32056619  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #16
Raw Score: 270; E-Value: 1e-151
Query Start/End: Original strand, 23 - 348
Target Start/End: Complemental strand, 17200225 - 17199900
Alignment:
23 atcatcaaagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatatta 122  Q
    ||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
17200225 atcattaaagcatagagactattatgtgggtagactgatgatcacatctcacagatcgtggataaagagttatcaagtcttcacatagatataaatatta 17200126  T
123 ggagtaatatttatattggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattc 222  Q
    |||||| ||||| ||||||||||| |||  ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
17200125 ggagtagtatttgtattggattgacccgctatgagaatactacatagtaaaagttatgaaaagtgtcataagatattctcatagtgatagtggtgtattc 17200026  T
223 cacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggtt 322  Q
    ||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||| ||||| |||| ||||||||||||||||||||||    
17200025 cacccttcgacctgaaaccactatgtaccttagatgttggagtcgagtgttttgtcaccattcaaatgttgttcgtatcaggatgactataaagttggtt 17199926  T
323 gatgggtactccatgaatcatgatga 348  Q
    ||||||||||||||||||||||||||    
17199925 gatgggtactccatgaatcatgatga 17199900  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #17
Raw Score: 261; E-Value: 1e-145
Query Start/End: Original strand, 23 - 344
Target Start/End: Original strand, 13516977 - 13517294
Alignment:
23 atcatcaaagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatatta 122  Q
    ||||| |||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
13516977 atcattaaagcacagagactattatgtgggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatatta 13517076  T
123 ggagtaatatttatattggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattc 222  Q
    |||||||||||||||||||||||||||  ||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||      |    
13517077 ggagtaatatttatattggattgatcctccatgagaatactaaatagtaaaagttatgaaaagtgtcataagatattctcatagtgatagtgg----ccc 13517172  T
223 cacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggtt 322  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||     
13517173 cacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttatcaccattcaaacgttgtccgtaacaggatgactataaagttggta 13517272  T
323 gatgggtactccatgaatcatg 344  Q
    ||||||||||||||||||||||    
13517273 gatgggtactccatgaatcatg 13517294  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #18
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 29 - 344
Target Start/End: Complemental strand, 1647556 - 1647241
Alignment:
29 aaagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatattaggagta 128  Q
    ||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||    
1647556 aaagcatagagactattatgtggatagactgatgatcacatctcacagatcatggataaagagttatcaagtctacacatagatataaatattaggagta 1647457  T
129 atatttatattggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattccaccct 228  Q
    || |||||||| ||||||  || ||||||||||||||||| |||||||||| |||||||||||| ||||||| |||||||||||||||||||||||||||    
1647456 atgtttatatttgattgactcgccatgagaatactacataataaaagttatgaaaagtgtcatacgatattcccatagtgatagtggtgtattccaccct 1647357  T
229 tcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggttgatggg 328  Q
    ||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |    
1647356 tcgacctaaaaccactatataccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaatttggttgatgag 1647257  T
329 tactccatgaatcatg 344  Q
    ||||||||||||||||    
1647256 tactccatgaatcatg 1647241  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #19
Raw Score: 243; E-Value: 1e-134
Query Start/End: Original strand, 23 - 344
Target Start/End: Original strand, 17136525 - 17136840
Alignment:
23 atcatcaaagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatatta 122  Q
    ||||| ||| ||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||      ||    
17136525 atcattaaaacatagagactattatgtgggtagactgatgatcacatttcacagatcatggataaagagttatcaagtcttcacatagatat------ta 17136618  T
123 ggagtaatatttatattggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattc 222  Q
    |||||||||||||||||||||||| ||  ||||||||||||||||||||||||||||  |||||||||||||||||||||||||||||||||||||||||    
17136619 ggagtaatatttatattggattgacccaccatgagaatactacatagtaaaagttattgaaagtgtcataagatattctcatagtgatagtggtgtattc 17136718  T
223 cacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggtt 322  Q
    ||||||||||| |||||||||||||||||||||||||||||||||||||||| || | ||||||||||||||||||||||||||||||||||||||||||    
17136719 cacccttcgacttgaaaccactatgtaccctagatgttggagtcgagtgcttagtaaacattcaaacgttgtccgtaacaggatgactataaagttggtt 17136818  T
323 gatgggtactccatgaatcatg 344  Q
    ||||| ||||||||||||||||    
17136819 gatggatactccatgaatcatg 17136840  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #20
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 23 - 344
Target Start/End: Original strand, 29925137 - 29925458
Alignment:
23 atcatcaaagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatatta 122  Q
    ||||| ||||||| ||| ||||||||| | ||||  ||||||||||||||| |||||||||||||||||| || ||||||||||||||||||||||||||    
29925137 atcattaaagcatggaggctattatgtggatagatcgatgatcacatctcatagatcatggataaagagtcattaagtcttcacatagatataaatatta 29925236  T
123 ggagtaatatttatattggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattc 222  Q
    |||||||||||||||||||||||| ||  |  ||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
29925237 ggagtaatatttatattggattgacccacctagagaatactgcatagtaaaagttatgaaaagtgtcataagatattctcatagtgatagtggtgtattc 29925336  T
223 cacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggtt 322  Q
    |||| || |||||||||||| ||||||||||||| |||||||| |||||||||||||||| |||||||||||| |||||| ||||| |||||||||||||    
29925337 caccatttgacctgaaaccattatgtaccctagacgttggagttgagtgctttgtcaccaatcaaacgttgtctgtaacaagatgattataaagttggtt 29925436  T
323 gatgggtactccatgaatcatg 344  Q
    ||||| ||||||| ||||||||    
29925437 gatggatactccacgaatcatg 29925458  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #21
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 23 - 344
Target Start/End: Original strand, 29974290 - 29974611
Alignment:
23 atcatcaaagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatatta 122  Q
    ||||| ||||||| ||| ||||||||| | ||||  ||||||||||||||| |||||||||||||||||| || ||||||||||||||||||||||||||    
29974290 atcattaaagcatggaggctattatgtggatagatcgatgatcacatctcatagatcatggataaagagtcattaagtcttcacatagatataaatatta 29974389  T
123 ggagtaatatttatattggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattc 222  Q
    |||||||||||||||||||||||| ||  |  ||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
29974390 ggagtaatatttatattggattgacccacctagagaatactgcatagtaaaagttatgaaaagtgtcataagatattctcatagtgatagtggtgtattc 29974489  T
223 cacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggtt 322  Q
    |||| || |||||||||||| ||||||||||||| |||||||| |||||||||||||||| |||||||||||| |||||| ||||| |||||||||||||    
29974490 caccatttgacctgaaaccattatgtaccctagacgttggagttgagtgctttgtcaccaatcaaacgttgtctgtaacaagatgattataaagttggtt 29974589  T
323 gatgggtactccatgaatcatg 344  Q
    ||||| ||||||| ||||||||    
29974590 gatggatactccacgaatcatg 29974611  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #22
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 54 - 344
Target Start/End: Original strand, 16200627 - 16200917
Alignment:
54 agactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatattaggagtaatatttatattggattgatccgtca 153  Q
    ||||||||||||| |||| |||||||||||||||||| ||||||||| |||| ||||||| |||||||||| |||||||| |||||||||||| ||  ||    
16200627 agactgatgatcatatcttacagatcatggataaagaattatcaagtattcatatagatacaaatattaggtgtaatattcatattggattgacccacca 16200726  T
154 tgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattccacccttcgacctgaaaccactatgtaccct 253  Q
    ||||||||||||||||| ||| ||||  ||||| ||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||    
16200727 tgagaatactacatagtcaaaattatgtaaagtatcataagatattctcatagtgatagtggtgtattcaaccctttgacctgaaaccactatgtaccct 16200826  T
254 agatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggttgatgggtactccatgaatcatg 344  Q
    |||||||| |||||||||||||||||||||||||| |||||| |||||| |||||||||||||||||||||||| ||||||| ||||||||    
16200827 agatgttgaagtcgagtgctttgtcaccattcaaatgttgtctgtaacaagatgactataaagttggttgatggatactccacgaatcatg 16200917  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #23
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 37 - 344
Target Start/End: Original strand, 21034238 - 21034540
Alignment:
37 gagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatattaggagtaatatttat 136  Q
    |||||||||||||| |||||||||||| | |||||||  | |||| ||||  ||| ||||||||||  ||||||||||||||||||||||||||||||||    
21034238 gagactattatgtatgtagactgatgaccgcatctcatgggtcatagatat-gagatatcaagtctatacatagatataaatattaggagtaatatttat 21034336  T
137 attggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattccacccttcgacctg 236  Q
    |||||||||| ||  | |||||||||||||||||  |||||||  ||| |||||||||||||||||| | ||||| |  |||||  | | ||| ||||||    
21034337 attggattgacccaccgtgagaatactacatagt--aagttat-gaaattgtcataagatattctcacaatgataataatgtatatcgctcttagacctg 21034433  T
237 aaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggttgatgggtactccat 336  Q
    |||||||||||  | ||||||| |||| || ||||||||||  |||||| ||||||||| |||| ||||| || |||| |||||||||||||||||  ||    
21034434 aaaccactatgatctctagatg-tggactcaagtgctttgttgccattctaacgttgtctgtaaaaggataacaataacgttggttgatgggtacttgat 21034532  T
337 gaatcatg 344  Q
    ||||||||    
21034533 gaatcatg 21034540  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #24
Raw Score: 101; E-Value: 5e-50
Query Start/End: Original strand, 37 - 344
Target Start/End: Complemental strand, 15846838 - 15846536
Alignment:
37 gagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatattaggagtaatatttat 136  Q
    |||||||||||||| |||||||||||| | |||||||  | |||| ||||  ||| ||||||||||  ||||||||||||||||||||||||||||||||    
15846838 gagactattatgtatgtagactgatgaccgcatctcatgggtcatagatat-gagatatcaagtctatacatagatataaatattaggagtaatatttat 15846740  T
137 attggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattccacccttcgacctg 236  Q
    |||||||||| ||  | |||||||||||||||||  |||||||  ||| |||||||||||||||||| | ||||| |  |||||  | | ||| ||||||    
15846739 attggattgacccaccgtgagaatactacatagt--aagttat-gaaattgtcataagatattctcacaatgataataatgtatatcgctcttagacctg 15846643  T
237 aaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggttgatgggtactccat 336  Q
    |||||||||||  ||||||||| |||| || |||| |||||  |||||| ||||||||| |||| ||||| |  |||| |||||||||||||||||  ||    
15846642 aaaccactatgatccctagatg-tggactcaagtgttttgttgccattctaacgttgtctgtaaaaggataatcataacgttggttgatgggtacttgat 15846544  T
337 gaatcatg 344  Q
    ||||||||    
15846543 gaatcatg 15846536  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #25
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 37 - 344
Target Start/End: Complemental strand, 20147856 - 20147554
Alignment:
37 gagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatattaggagtaatatttat 136  Q
    |||||||||||||| |||||||||||| | |||||||  | |||| ||||  ||| ||||||||||  ||||||||||||||||||||||||||||||||    
20147856 gagactattatgtatgtagactgatgaccgcatctcatgggtcatagatat-gagatatcaagtctatacatagatataaatattaggagtaatatttat 20147758  T
137 attggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattccacccttcgacctg 236  Q
    |||||||||| ||    |||||||||||||||||  |||||||  ||| |||||||||||||||||| | ||||| |  |||||  | | ||| ||||||    
20147757 attggattgacccactgtgagaatactacatagt--aagttat-gaaattgtcataagatattctcacaatgataataatgtatatcgctcttagacctg 20147661  T
237 aaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggttgatgggtactccat 336  Q
    |||||||||||  | ||||||| |||| || ||||||||||  |||||| ||||||||| |||| ||||| || |||| ||||||||||||| |||  ||    
20147660 aaaccactatgatctctagatg-tggactcaagtgctttgttgccattctaacgttgtctgtaaaaggataacaataacgttggttgatgggcacttgat 20147562  T
337 gaatcatg 344  Q
    ||||||||    
20147561 gaatcatg 20147554  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #26
Raw Score: 93; E-Value: 3e-45
Query Start/End: Original strand, 37 - 344
Target Start/End: Original strand, 21398792 - 21399094
Alignment:
37 gagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatattaggagtaatatttat 136  Q
    |||||||||||||| ||||||| |||| | |||||||  | |||| ||||  ||| ||||||||||  |||||| |||||||||||||||||||||||||    
21398792 gagactattatgtatgtagacttatgacctcatctcatgggtcatagatat-gagatatcaagtctatacataggtataaatattaggagtaatatttat 21398890  T
137 attggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattccacccttcgacctg 236  Q
    |||||||||| ||  | |||||||||||||||||  |||||||  ||| |||||||||||||||| | | ||||| |  |||||  | | ||| ||||||    
21398891 attggattgacccaccgtgagaatactacatagt--aagttat-gaaattgtcataagatattcttacaatgataataatgtatatcgctcttagacctg 21398987  T
237 aaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggttgatgggtactccat 336  Q
    |||||||||||  ||||||||| |||| || ||||||||||  |||||| ||||||||| |||| ||||| |  |||| |||||||||||||||||  ||    
21398988 aaaccactatgatccctagatg-tggactcaagtgctttgttgccattctaacgttgtctgtaaaaggataatcataacgttggttgatgggtacttgat 21399086  T
337 gaatcatg 344  Q
    ||||||||    
21399087 gaatcatg 21399094  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #27
Raw Score: 91; E-Value: 5e-44
Query Start/End: Original strand, 29 - 326
Target Start/End: Complemental strand, 24253423 - 24253130
Alignment:
29 aaagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatattaggagta 128  Q
    ||||||||||||||||||||| |||||||| ||||||| |||||||  || ||||||||||||||||||||| ||||||||  |||||| |||| ||||     
24253423 aaagcatagagactattatgtcggtagactaatgatcatatctcacgaattatggataaagagttatcaagttttcacatacttataaacattaagagtt 24253324  T
129 atatttatattggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattccaccct 228  Q
    ||||||||||||| |||| ||  |||||||||| | |||||  || |||||   |||  ||||||| ||||||||||||||||  ||||||||||| | |    
24253323 atatttatattggtttgaccctccatgagaataatgcatag--aatgttat-ttaaggatcataagttattctcatagtgataacggtgtattcca-cat 24253228  T
229 tcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggttgatg 326  Q
    ||||||| ||||||||||||||| |||||||  || |||||| ||||||   | ||||||| |||||  | ||||  |||| |||||||| |||||||    
24253227 tcgacctaaaaccactatgtaccttagatgtatgactcgagtactttgttgtcgttcaaacattgtcaattacagagtgaccataaagttagttgatg 24253130  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #28
Raw Score: 89; E-Value: 8e-43
Query Start/End: Original strand, 37 - 344
Target Start/End: Original strand, 14890391 - 14890693
Alignment:
37 gagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatattaggagtaatatttat 136  Q
    |||||||||||||| |||||||||||| | |||||||  | |||| ||||  ||| ||||||||||  ||||||||||||||||||||||||||||||||    
14890391 gagactattatgtatgtagactgatgaccgcatctcatgggtcatagatat-gagatatcaagtctatacatagatataaatattaggagtaatatttat 14890489  T
137 attggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattccacccttcgacctg 236  Q
    |||||||||| ||  | |||||||||||||||||  |||||||  ||| |||||||||||||||||| | ||||| |  |||||    | ||| ||||||    
14890490 attggattgacccaccgtgagaatactacatagt--aagttat-gaaattgtcataagatattctcacaatgataataatgtatattgctcttagacctg 14890586  T
237 aaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggttgatgggtactccat 336  Q
    ||| |||| ||  | ||||||| |||| || ||||||||||   ||||| ||||||||| |||| ||||| | ||||| |||||||||||||||||  ||    
14890587 aaagcactgtgatctctagatg-tggactcaagtgctttgttgtcattctaacgttgtctgtaaaaggataattataacgttggttgatgggtacttgat 14890685  T
337 gaatcatg 344  Q
    ||||||||    
14890686 gaatcatg 14890693  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #29
Raw Score: 89; E-Value: 8e-43
Query Start/End: Original strand, 37 - 344
Target Start/End: Original strand, 55427021 - 55427323
Alignment:
37 gagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatattaggagtaatatttat 136  Q
    |||||||||||||| |||||||||||| | |||||||  | |||| ||||  ||| ||| ||||||  ||||||||||||||||||| ||||||||||||    
55427021 gagactattatgtatgtagactgatgaccgcatctcatgggtcatagatat-gagatattaagtctatacatagatataaatattagaagtaatatttat 55427119  T
137 attggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattccacccttcgacctg 236  Q
    |||||||||| ||    |||||||||||||||||  |||||||  ||| |||||||||||||||||| | ||||| |  |||||    | ||| ||||||    
55427120 attggattgacccactgtgagaatactacatagt--aagttat-gaaattgtcataagatattctcacaatgataataatgtatattgctcttagacctg 55427216  T
237 aaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggttgatgggtactccat 336  Q
    |||||||||||  | ||||||| |||| || ||||||||||  |||||| ||||||||| |||| ||||| || |||| |||||||||||||||||  ||    
55427217 aaaccactatgatctctagatg-tggactcaagtgctttgttgccattctaacgttgtctgtaaaaggataacaataacgttggttgatgggtacttgat 55427315  T
337 gaatcatg 344  Q
    ||||||||    
55427316 gaatcatg 55427323  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #30
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 37 - 344
Target Start/End: Original strand, 12299911 - 12300212
Alignment:
37 gagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatattaggagtaatatttat 136  Q
    |||||||||||||| |||||||||||| | |||||||  | |||| ||||  ||| ||||||||||   ||||||||||||| |||||||||||||||||    
12299911 gagactattatgtatgtagactgatgaccgcatctcatgggtcatagatat-gagatatcaagtctat-catagatataaatgttaggagtaatatttat 12300008  T
137 attggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattccacccttcgacctg 236  Q
    |||||||||| ||    |||||||||||||||||  |||||||  ||| |||||||||||||||||| | ||||| |  |||||  | | ||| ||||||    
12300009 attggattgacccactgtgagaatactacatagt--aagttat-gaaattgtcataagatattctcacaatgataataatgtatatcgctcttagacctg 12300105  T
237 aaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggttgatgggtactccat 336  Q
    |||||||||||  | ||||||| |||| || |||| |||||  |||||| ||||||||| |||| ||||| || |||| |||||||||||||||||  ||    
12300106 aaaccactatgatctctagatg-tggactcaagtgatttgttgccattctaacgttgtctgtaaaaggataacaataacgttggttgatgggtacttgat 12300204  T
337 gaatcatg 344  Q
    ||||||||    
12300205 gaatcatg 12300212  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #31
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 105 - 344
Target Start/End: Complemental strand, 25978963 - 25978728
Alignment:
105 acatagatataaatattaggagtaatatttatattggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcat 204  Q
    |||||| ||||| |||||||||||||||||||| ||||| || ||  | |||||||||||||||||||  ||||| | |  ||||||||||||||||||     
25978963 acataggtataattattaggagtaatatttatactggatagacccaccgtgagaatactacatagtaa--gttatgagat-tgtcataagatattctcac 25978867  T
205 agtgatagtggtgtattccacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacagg 304  Q
    | ||||| | ||||||  | | ||| |||||||||||||||||  |||||||||| ||| || ||| ||||||  |||||| ||||||||| |||| |||    
25978866 aatgataatagtgtatatcgctcttagacctgaaaccactatgatccctagatgt-ggactcaagtactttgttgccattctaacgttgtctgtaaaagg 25978768  T
305 atgactataaagttggttgatgggtactccatgaatcatg 344  Q
    || || |||| |||||||||||||||||  ||||||||||    
25978767 ataaccataacgttggttgatgggtacttgatgaatcatg 25978728  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #32
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 29 - 246
Target Start/End: Original strand, 14147013 - 14147226
Alignment:
29 aaagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatattaggagta 128  Q
    |||||| |||||||||||| || |||||||||||| |||||||||  | |||||||||  ||| ||| ||||||  |||||  ||||||||||||||| |    
14147013 aaagcacagagactattatatatgtagactgatgaccacatctcatgggtcatggatat-gagatattaagtctatacatatgtataaatattaggagga 14147111  T
129 atatttatattggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattccaccct 228  Q
    ||||||||| |||||||| | | | ||||||| |||||||||  | ||||| |||| |||| ||||||||||||| | |||||  |||||||  ||| ||    
14147112 atatttatactggattgacctgccgtgagaatgctacatagt--atgttatgaaaa-tgtcgtaagatattctcacattgataaaggtgtatatcactct 14147208  T
229 tcgacctgaaaccactat 246  Q
    | ||||||||||||||||    
14147209 tagacctgaaaccactat 14147226  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #33
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 112 - 310
Target Start/End: Original strand, 15526827 - 15527021
Alignment:
112 tataaatattaggagtaatatttatattggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgata 211  Q
    ||||||| |||||||||||||||||| |||||||| || || ||||| ||||| ||||||   | ||| |||| |||||||||||||||| | | || ||    
15526827 tataaatcttaggagtaatatttatactggattgacccatcgtgagagtactaaatagtat--gctatgaaaa-tgtcataagatattcttacaatgtta 15526923  T
212 gtggtgtattccacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgact 310  Q
     |||||||| |||| ||| |||||||||||||||||  || || ||| |||| || |||||||| | ||||||||||||||||| ||||||| ||||||    
15526924 atggtgtataccactcttagacctgaaaccactatgatccatacatg-tggactcaagtgctttataaccattcaaacgttgtctgtaacagcatgact 15527021  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #34
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 186 - 344
Target Start/End: Original strand, 28088251 - 28088408
Alignment:
186 tgtcataagatattctcatagtgatagtggtgtattccacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattc 285  Q
    |||||||||||||||||| | ||||| | ||||||  | | ||| |||||||||||||||||  ||||||||| |||| || || |||||||  ||||||    
28088251 tgtcataagatattctcacaatgataatagtgtatatcgctcttagacctgaaaccactatgatccctagatg-tggactcaagggctttgttgccattc 28088349  T
286 aaacgttgtccgtaacaggatgactataaagttggttgatgggtactccatgaatcatg 344  Q
     ||||||||| |||| ||||| || |||| |||||||||||| ||||  ||||||||||    
28088350 taacgttgtctgtaaaaggataaccataacgttggttgatggatacttgatgaatcatg 28088408  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #35
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 105 - 344
Target Start/End: Original strand, 11787654 - 11787889
Alignment:
105 acatagatataaatattaggagtaatatttatattggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcat 204  Q
    |||||| |||||||||||||||||||||||||| ||||| || ||  | |||||||||||||||||  |||||||  | | | ||||||||||||||||     
11787654 acataggtataaatattaggagtaatatttatactggatagacccaccgtgagaatactacatagt--aagttat-gatattttcataagatattctcac 11787750  T
205 agtgatagtggtgtattccacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacagg 304  Q
    | ||||| |  |||||  | | ||| |||||||||||| ||||  ||||||||  |  | || ||| ||||||  |||||| ||||||||| ||||  ||    
11787751 aatgataatattgtatatcgctcttagacctgaaaccattatgatccctagat-ctataatcaagtactttgttgccattctaacgttgtctgtaaatgg 11787849  T
305 atgactataaagttggttgatgggtactccatgaatcatg 344  Q
    || || |||| |||||||||||||||||  ||||||||||    
11787850 ataaccataacgttggttgatgggtacttaatgaatcatg 11787889  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #36
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 40 - 344
Target Start/End: Complemental strand, 15317472 - 15317176
Alignment:
40 actattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatattaggagtaatatttatatt 139  Q
    ||||||||||| ||||| |||||| | |||||||  | | || ||||  ||| ||| ||||||  |||||| |||||||||||||||||||||||||| |    
15317472 actattatgtatgtagattgatgaccgcatctcatgggttatagatat-gagatattaagtctatacataggtataaatattaggagtaatatttatact 15317374  T
140 ggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattccacccttcgacctgaaa 239  Q
     ||| || ||  | |||||||||||||||||  | |||||  | | |||||||||||||||||| | ||||| | |||||   | | ||| |||||||||    
15317373 agatagacccaccgtgagaatactacatagt--acgttat-gagattgtcataagatattctcacaatgataatagtgtaaatcgctcttagacctgaaa 15317277  T
240 ccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggttgatgggtactccatgaa 339  Q
    ||||||||  ||||||||| |||| || ||| ||||||   ||||| ||||||||| ||||  |||| |  |||| ||||||||| |||||||  |||||    
15317276 ccactatgatccctagatg-tggactcaagtactttgt---cattctaacgttgtctgtaaacggataatcataacgttggttgacgggtacttgatgaa 15317181  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #37
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 76 - 205
Target Start/End: Original strand, 28953965 - 28954093
Alignment:
76 gatcatggataaagagttatcaagtcttcacatagatataaatattaggagtaatattt-atattggattgatccgtcatgagaatactacatagtaaaa 174  Q
    |||||| ||||||||||||  |||||||||||||  |||| | ||||||||||||||||  | ||||||| | || ||||||||||||||||||  | ||    
28953965 gatcattgataaagagttacaaagtcttcacatatgtatacacattaggagtaatatttgttgttggattaacccatcatgagaatactacata--ataa 28954062  T
175 gttataaaaagtgtcataagatattctcata 205  Q
    |||||  ||||||||||| ||||||||||||    
28954063 gttatttaaagtgtcatatgatattctcata 28954093  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #38
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 23 - 75
Target Start/End: Complemental strand, 19089786 - 19089734
Alignment:
23 atcatcaaagcatagagactattatgtaggtagactgatgatcacatctcaca 75  Q
    ||||| ||| |||||||||||||||||||||||||||||||||||||||||||    
19089786 atcattaaatcatagagactattatgtaggtagactgatgatcacatctcaca 19089734  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #39
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 78 - 270
Target Start/End: Original strand, 32280313 - 32280507
Alignment:
78 tcatggataaagagttatcaagtcttcacatagatataaatattaggagtaatatttatattggattgatccgtcatgagaatactacatagtaaaagtt 177  Q
    ||||||||||||||||||  | ||||||||||| |||||  |||| || ||||||||| | | | |||| ||   ||||||||| |||||||| |  ||     
32280313 tcatggataaagagttatttaatcttcacataggtataatcattacgaataatatttacactcggttgacccacaatgagaataatacatagtga--gtc 32280410  T
178 ataaaaagtgtcataagatattctcatagtgatagtggtgtattccacccttcgacctgaaaccac----tatgtaccctagatgttggagtcgagt 270  Q
    ||  |||||||||||||||||||||||||||||| || | ||||  ||| ||  || |||||||||    |||||||||||||||| ||||||||||    
32280411 atgtaaagtgtcataagatattctcatagtgataatgatttattttaccttttcacttgaaaccactatatatgtaccctagatgtaggagtcgagt 32280507  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #40
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 29 - 122
Target Start/End: Original strand, 9504455 - 9504548
Alignment:
29 aaagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatatta 122  Q
    |||| ||||| |||||||||| ||||||||||| |||  ||||||| | |||||||||| |||||||||||| || ||||| ||| ||||||||    
9504455 aaaggatagaaactattatgtgggtagactgataatcttatctcacgggtcatggataaggagttatcaagtattaacatacataaaaatatta 9504548  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #41
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 33 - 148
Target Start/End: Complemental strand, 8252048 - 8251933
Alignment:
33 catagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatattaggagtaatat 132  Q
    |||| ||||||| |||| | | |||||| |||||||||| || ||||||| |||||  |||||||| |||| ||||| || || |||||  |||||||||    
8252048 catatagactatcatgtggatggactgaagatcacatcttacggatcatgaataaaatgttatcaaatctttacataaatttacatatttcgagtaatat 8251949  T
133 ttatattggattgatc 148  Q
    ||||||| ||||||||    
8251948 ttatatttgattgatc 8251933  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #42
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 191 - 306
Target Start/End: Original strand, 30464147 - 30464261
Alignment:
191 taagatattctcatagtgatagtggtgtattccacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacg 290  Q
    ||||||||||||||| ||||| |||| ||| |||| ||| |||||||||||||||||  ||||||||| |||| || |||| ||| |   ||||||||||    
30464147 taagatattctcataatgataatggtctataccactcttagacctgaaaccactatgatccctagatg-tggactcaagtgttttattgacattcaaacg 30464245  T
291 ttgtccgtaacaggat 306  Q
    ||||| |||| |||||    
30464246 ttgtctgtaaaaggat 30464261  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #43
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 23 - 96
Target Start/End: Original strand, 16200291 - 16200363
Alignment:
23 atcatcaaagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatc 96  Q
    ||||| ||||||| ||||||||| ||| |  ||||||||||||| |||| ||||||||||||||||||||||||    
16200291 atcattaaagcatggagactatt-tgtggagagactgatgatcatatcttacagatcatggataaagagttatc 16200363  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #44
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 183 - 247
Target Start/End: Complemental strand, 36138097 - 36138033
Alignment:
183 aagtgtcataagatattctcatagtgatagtggtgtattccacccttcgacctgaaaccactatg 247  Q
    ||||| |||||||||||  || ||||||| |||||||| ||||||||| |||||||| |||||||    
36138097 aagtgccataagatatttccaaagtgataatggtgtataccacccttcaacctgaaatcactatg 36138033  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #45
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 116 - 168
Target Start/End: Original strand, 4189223 - 4189275
Alignment:
116 aatattaggagtaatatttatattggattgatccgtcatgagaatactacata 168  Q
    ||||||| |||||||||||||| |  ||||||| |||||||||||| ||||||    
4189223 aatattatgagtaatatttatactatattgatctgtcatgagaatattacata 4189275  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #46
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 183 - 247
Target Start/End: Original strand, 36142816 - 36142880
Alignment:
183 aagtgtcataagatattctcatagtgatagtggtgtattccacccttcgacctgaaaccactatg 247  Q
    ||||| |||||||||||  || ||||||| || |||||  |||||||| ||||||||||||||||    
36142816 aagtgccataagatatttccaaagtgataatgatgtatgtcacccttcaacctgaaaccactatg 36142880  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 310; Significance: 1e-174; HSPs: 38)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 310; E-Value: 1e-174
Query Start/End: Original strand, 23 - 344
Target Start/End: Original strand, 18252196 - 18252517
Alignment:
23 atcatcaaagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatatta 122  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
18252196 atcattaaagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatatta 18252295  T
123 ggagtaatatttatattggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattc 222  Q
    |||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
18252296 ggagtaatatttatattggattgatccgccatgagaatactacatagtaaaagttatgaaaagtgtcataagatattctcatagtgatagtggtgtattc 18252395  T
223 cacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggtt 322  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
18252396 cacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggtt 18252495  T
323 gatgggtactccatgaatcatg 344  Q
    ||||||||||||||||||||||    
18252496 gatgggtactccatgaatcatg 18252517  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 306; E-Value: 1e-172
Query Start/End: Original strand, 23 - 344
Target Start/End: Complemental strand, 18532555 - 18532234
Alignment:
23 atcatcaaagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatatta 122  Q
    ||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
18532555 atcattaaagcatagagactattatgtagatagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatatta 18532456  T
123 ggagtaatatttatattggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattc 222  Q
    |||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
18532455 ggagtaatatttatattggattgatccgccatgagaatactacatagtaaaagttatgaaaagtgtcataagatattctcatagtgatagtggtgtattc 18532356  T
223 cacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggtt 322  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
18532355 cacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggtt 18532256  T
323 gatgggtactccatgaatcatg 344  Q
    ||||||||||||||||||||||    
18532255 gatgggtactccatgaatcatg 18532234  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 298; E-Value: 1e-167
Query Start/End: Original strand, 23 - 344
Target Start/End: Complemental strand, 27131450 - 27131130
Alignment:
23 atcatcaaagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatatta 122  Q
    ||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
27131450 atcattaaagcataaagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatatta 27131351  T
123 ggagtaatatttatattggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattc 222  Q
    |||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
27131350 ggagtaatatttatattggattgatccgccatgagaatactacatagtaaaagttatgaaaagtgtcataagatattctcatagtgatagtggtgtattc 27131251  T
223 cacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggtt 322  Q
    ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
27131250 cacccttcgacctgaaaccactatgta-cctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggtt 27131152  T
323 gatgggtactccatgaatcatg 344  Q
    ||||||||||||||||||||||    
27131151 gatgggtactccatgaatcatg 27131130  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 290; E-Value: 1e-163
Query Start/End: Original strand, 23 - 344
Target Start/End: Complemental strand, 27310618 - 27310297
Alignment:
23 atcatcaaagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatatta 122  Q
    ||||| ||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||    
27310618 atcattaaagcatagagactattatgtgggtagactgatgatcacatctcacagattatggataaagagttatcaagtcttcacataaatataaatatta 27310519  T
123 ggagtaatatttatattggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattc 222  Q
    |||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||    
27310518 ggagtaatatttatattggattgatccgccatgagaatactacatagtaaaagttatgaaaagtgtcataagatattcttatagtgatagtggtgtattc 27310419  T
223 cacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggtt 322  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||    
27310418 cacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtctgtaacaggatgactataaagttggtt 27310319  T
323 gatgggtactccatgaatcatg 344  Q
    ||||||||||||||||||||||    
27310318 gatgggtactccatgaatcatg 27310297  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 274; E-Value: 1e-153
Query Start/End: Original strand, 23 - 344
Target Start/End: Complemental strand, 16359076 - 16358755
Alignment:
23 atcatcaaagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatatta 122  Q
    ||||| ||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||    
16359076 atcattaaagcatagagactattatgtgggtagactgatgatcacatctcacagataatggataaagagttatcaagccttcacatagatataaatatta 16358977  T
123 ggagtaatatttatattggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattc 222  Q
     ||||||||||||||||||||||||||| |||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||    
16358976 tgagtaatatttatattggattgatccgccatgagaatactacatagtaaaagttatgagaagtgtcataagatattctcatagtgatagtggtgtattc 16358877  T
223 cacccttcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggtt 322  Q
    ||||||||| | ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||    
16358876 cacccttcgtcttgaaaccaccatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactttaaagttggtt 16358777  T
323 gatgggtactccatgaatcatg 344  Q
    ||||||||||||||||||||||    
16358776 gatgggtactccatgaatcatg 16358755  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 29 - 344
Target Start/End: Complemental strand, 3855954 - 3855639
Alignment:
29 aaagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatattaggagta 128  Q
    ||||||| |||||||||| || ||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||| |||||||||||||||||    
3855954 aaagcatggagactattacgtgggtagactgatgatcacatctcacaaatcatggataaagagttataaagtcttcacataggtataaatattaggagta 3855855  T
129 atatttatattggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattccaccct 228  Q
    |||||||||||||||||| |||  ||||||||||||||||||||| ||||| ||||||||||||||||||||||| |||||||||||||||||||||| |    
3855854 atatttatattggattgacccgcaatgagaatactacatagtaaaggttatgaaaagtgtcataagatattctcacagtgatagtggtgtattccaccat 3855755  T
229 tcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggttgatggg 328  Q
    |||||| |||||||||||||||||||||||||||||| ||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||  ||    
3855754 tcgacccgaaaccactatgtaccctagatgttggagttgagcgctttgtcaccattcaagcgttgtccgtaacaggatgactataaagttggttgaccgg 3855655  T
329 tactccatgaatcatg 344  Q
    ||||||||||||||||    
3855654 tactccatgaatcatg 3855639  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 29 - 344
Target Start/End: Complemental strand, 36816668 - 36816354
Alignment:
29 aaagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatattaggagta 128  Q
    ||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||    
36816668 aaagcatagagactattatgtggatagactgatgatcacatctcacagatcatggataaagagttatcaagtctacacatagatataaatattaggagta 36816569  T
129 atatttatattggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattccaccct 228  Q
    |||||||||||||||||| ||  |||||||||||||||||||||||||||| ||||||||||||| | ||| |||||||||| |||||||||||||||||    
36816568 atatttatattggattgacccaccatgagaatactacatagtaaaagttatgaaaagtgtcataa-aaattatcatagtgatggtggtgtattccaccct 36816470  T
229 tcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggttgatggg 328  Q
    | || |||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||| |||||| ||| |||||||||||||||||| ||    
36816469 ttgaactgaaaccactatgtaccctagatgttggagtcgagcgttttgtcaccattcaaacgttgtctgtaacaagataactataaagttggttgatagg 36816370  T
329 tactccatgaatcatg 344  Q
    |||||||  |||||||    
36816369 tactccacaaatcatg 36816354  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 63 - 344
Target Start/End: Complemental strand, 22641871 - 22641594
Alignment:
63 atcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatattaggagtaatatttatattggattgatccgtcatgagaatac 162  Q
    ||||||||||| ||||||||||||||||||||| |||| |||||||||||||||   |||||| ||||||||||| | |||||| ||  |||||||| ||    
22641871 atcacatctcatagatcatggataaagagttattaagtgttcacatagatataa---ttaggaataatatttatactagattgacccaccatgagaa-ac 22641776  T
163 tacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattccacccttcgacctgaaaccactatgtaccctagatgttgg 262  Q
    ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||    
22641775 tacatagtaaaagttataaaaagtgtcataagatattctcacagtgatagtggtgtattccacccttcgacctgaaaccactatgtaccgtagatgttgg 22641676  T
263 agtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggttgatgggtactccatgaatcatg 344  Q
    ||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||| ||||||||||||| ||||||||    
22641675 agtcgagtgctttgtcaccattcaaacgttgtctgtaacaagatgactataaagttggtcgatgggtactccacgaatcatg 22641594  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #9
Raw Score: 184; E-Value: 2e-99
Query Start/End: Original strand, 29 - 344
Target Start/End: Complemental strand, 27277592 - 27277278
Alignment:
29 aaagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatattaggagta 128  Q
    ||||||||||||||||||||| ||||||| |||||||||||||||| |||||| ||||||||||||||| || ||||||||| |||||||||||||||||    
27277592 aaagcatagagactattatgtgggtagaccgatgatcacatctcacggatcatagataaagagttatcatgttttcacataggtataaatattaggagta 27277493  T
129 atatttatattggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattccaccct 228  Q
    ||||||||| | |||||| ||  ||| |||||| | |||||||||||| || ||| ||| ||||||||||||| ||||||||||||||||||||||||||    
27277492 atatttatactagattgacccaccataagaatattgcatagtaaaagtcatgaaa-gtgccataagatattcttatagtgatagtggtgtattccaccct 27277394  T
229 tcgacctgaaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggttgatggg 328  Q
    | ||||||||||||||||||||||| ||||||||||||||||||||| |||  |||||||| ||||  |||||| |||||| |||||||||||||| |||    
27277393 ttgacctgaaaccactatgtaccctggatgttggagtcgagtgctttatcataattcaaacattgtttgtaacaagatgaccataaagttggttgaaggg 27277294  T
329 tactccatgaatcatg 344  Q
    |||||||| |||||||    
27277293 tactccataaatcatg 27277278  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #10
Raw Score: 170; E-Value: 4e-91
Query Start/End: Original strand, 23 - 216
Target Start/End: Complemental strand, 21171274 - 21171081
Alignment:
23 atcatcaaagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatatta 122  Q
    ||||| |||||||| |||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
21171274 atcattaaagcataaagactattatgtgggtagactgatgataacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatatta 21171175  T
123 ggagtaatatttatattggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggt 216  Q
    |||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||    
21171174 ggagtaatatttatattggattgatccgccatgagaatactacatagtaaaagttatgaaaagtgtcataagatattctcatagtgatagtggt 21171081  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #11
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 37 - 344
Target Start/End: Complemental strand, 19706741 - 19706439
Alignment:
37 gagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatattaggagtaatatttat 136  Q
    |||||||||||||| |||||||||||| | |||||||  | |||| ||||  ||| ||||||||||  ||||||||||||||||||||||||||||||||    
19706741 gagactattatgtatgtagactgatgaccgcatctcatgggtcatagatat-gagatatcaagtctatacatagatataaatattaggagtaatatttat 19706643  T
137 attggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattccacccttcgacctg 236  Q
    |||||||||| ||  | |||||||||||||||||  |||||||  ||| |||||||||||||||||| | ||||| |  |||||  | | ||| ||||||    
19706642 attggattgacccaccgtgagaatactacatagt--aagttat-gaaattgtcataagatattctcacaatgataataatgtatatcgctcttagacctg 19706546  T
237 aaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggttgatgggtactccat 336  Q
    |||||||||||  ||||||||| |||| || ||||||||||  |||||| ||||||||| |||| ||||| |  |||| |||||||||||||||||  ||    
19706545 aaaccactatgatccctagatg-tggactcaagtgctttgttgccattctaacgttgtctgtaaaaggataatcataacgttggttgatgggtacttgat 19706447  T
337 gaatcatg 344  Q
    ||||||||    
19706446 gaatcatg 19706439  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #12
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 37 - 344
Target Start/End: Complemental strand, 43802667 - 43802365
Alignment:
37 gagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatattaggagtaatatttat 136  Q
    |||||||||||||| |||||||||||| | |||||||  | |||| ||||  ||| ||||||||||  ||||||||||||||||||||||||||||||||    
43802667 gagactattatgtatgtagactgatgaccgcatctcatgggtcatagatat-gagatatcaagtctatacatagatataaatattaggagtaatatttat 43802569  T
137 attggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattccacccttcgacctg 236  Q
    |||||||||| ||  | |||||||||||||||||  |||||||  ||| |||||||||||||||||| | ||||| |  |||||  | | ||| ||||||    
43802568 attggattgacccaccgtgagaatactacatagt--aagttat-gaaattgtcataagatattctcacaatgataataatgtatatcgctcttagacctg 43802472  T
237 aaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggttgatgggtactccat 336  Q
    |||||||||||  ||||||||| |||| || ||||||||||  |||||| ||||||||| |||| ||||| |  |||| |||||||||||||||||  ||    
43802471 aaaccactatgatccctagatg-tggactcaagtgctttgttgccattctaacgttgtctgtaaaaggataatcataacgttggttgatgggtacttgat 43802373  T
337 gaatcatg 344  Q
    ||||||||    
43802372 gaatcatg 43802365  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #13
Raw Score: 101; E-Value: 5e-50
Query Start/End: Original strand, 37 - 344
Target Start/End: Complemental strand, 28135025 - 28134723
Alignment:
37 gagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatattaggagtaatatttat 136  Q
    ||||| |||||||| |||||||||||| | |||||||  | |||| ||||  ||| ||||||||||  ||||||||||||||||||||||||||||||||    
28135025 gagacaattatgtatgtagactgatgaccgcatctcatgggtcatagatat-gagatatcaagtctatacatagatataaatattaggagtaatatttat 28134927  T
137 attggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattccacccttcgacctg 236  Q
    |||||||||||||  | |||||||||||||||||  |||||||  ||| |||||||||||||||||| | ||||| |  |||||  | | ||| ||||||    
28134926 attggattgatccaccgtgagaatactacatagt--aagttat-gaaattgtcataagatattctcacaatgataataatgtatatcgctcttagacctg 28134830  T
237 aaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggttgatgggtactccat 336  Q
    |||||||||||  ||||| ||| |||| || ||||||||||  |||||| ||||||||| |||| ||||| |  |||| |||||||||||||||||  ||    
28134829 aaaccactatgatccctaaatg-tggactcaagtgctttgttgccattctaacgttgtctgtaaaaggataatcataacgttggttgatgggtacttgat 28134731  T
337 gaatcatg 344  Q
    ||||||||    
28134730 gaatcatg 28134723  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #14
Raw Score: 99; E-Value: 9e-49
Query Start/End: Original strand, 23 - 177
Target Start/End: Complemental strand, 22657262 - 22657108
Alignment:
23 atcatcaaagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatatta 122  Q
    ||||| |||||||||||||||| |||| | ||||||||||||||||||||| || |||| ||||||||||||| ||||||||||||||||||||||||||    
22657262 atcattaaagcatagagactatcatgtggatagactgatgatcacatctcatagctcatagataaagagttattaagtcttcacatagatataaatatta 22657163  T
123 ggagtaatatttatattggattgatccgtcatgagaatactacatagtaaaagtt 177  Q
     |||||||||||||||| |||||| ||  |||| |||||||||||||||||||||    
22657162 tgagtaatatttatattagattgacccaccatgtgaatactacatagtaaaagtt 22657108  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #15
Raw Score: 99; E-Value: 9e-49
Query Start/End: Original strand, 53 - 344
Target Start/End: Original strand, 23507096 - 23507385
Alignment:
53 tagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatattaggagtaatatttatattggattgatccgtc 152  Q
    |||||||||||||||||||||| |||||||||||| |||||||||||| |||||||||||||||||| |||||||||||||||||||||||| | ||  |    
23507096 tagactgatgatcacatctcacggatcatggataaggagttatcaagttttcacatagatataaataataggagtaatatttatattggattaacccacc 23507195  T
153 atgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgat-agtggtgtattccacccttcgacctgaaaccactatgtacc 251  Q
    || ||||| ||||| || |     | |||||||   |||||| ||||||||||||||| ||||| ||||  || ||||||||||||||||||| ||||||    
23507196 attagaatgctacagagaacgttgtgtaaaaag---cataagttattctcatagtgataagtggagtatgtcatccttcgacctgaaaccactgtgtacc 23507292  T
252 ctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggttgatgggtactccatgaatcatg 344  Q
    ||||||||  || | |||| |||||| | ||| ||||    ||| |||| |||||||||||||| | | || ||||||||||||| |||||||    
23507293 ctagatgtaagatttgagtactttgttatcatacaaataccgtctgtaataggatgactataaattcgatttatgggtactccataaatcatg 23507385  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #16
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 37 - 344
Target Start/End: Original strand, 9456116 - 9456418
Alignment:
37 gagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatattaggagtaatatttat 136  Q
    |||||||||||||| |||||||||||| | |||||||  | |||| ||||  ||| ||||||||||  ||||||||||||||||||||||||||||||||    
9456116 gagactattatgtatgtagactgatgaccgcatctcatgggtcatagatat-gagatatcaagtctatacatagatataaatattaggagtaatatttat 9456214  T
137 attggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattccacccttcgacctg 236  Q
    |||||||||| ||    |||||||||||||||||  |||||||  ||| |||||||||||||||||| | ||||| |  |||||  | | ||| ||||||    
9456215 attggattgacccactgtgagaatactacatagt--aagttat-gaaattgtcataagatattctcacaatgataataatgtatatcgctcttagacctg 9456311  T
237 aaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggttgatgggtactccat 336  Q
    |||||||||||  | ||||||| |||| || ||||||||||  |||||| ||||||||| |||| ||||| || |||| ||||||||||||| |||  ||    
9456312 aaaccactatgatctctagatg-tggactcaagtgctttgttgccattctaacgttgtctgtaaaaggataacaataacgttggttgatgggcacttgat 9456410  T
337 gaatcatg 344  Q
    ||||||||    
9456411 gaatcatg 9456418  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #17
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 151 - 344
Target Start/End: Complemental strand, 9916689 - 9916497
Alignment:
151 tcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgata-gtggtgtattccacccttcgacctgaaa-ccactatgt 248  Q
    |||||||||||||||||||  ||||||||  ||| ||||||||  |||||||||||||||| |||||||||||||||||||||||||||| |||||||||    
9916689 tcatgagaatactacatag--aaagttatgtaaa-tgtcataaattattctcatagtgataagtggtgtattccacccttcgacctgaaaaccactatgt 9916593  T
249 accctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggttgatgggtactccatgaatcatg 344  Q
    ||||||||||| |||||||||| |||||| ||| | |||||||||||||||||| | ||||||||||||| ||| ||| || ||||| ||||||||    
9916592 accctagatgtaggagtcgagtactttgttaccgtccaaacgttgtccgtaacaaggtgactataaagttagtttatgagttctccacgaatcatg 9916497  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #18
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 29 - 266
Target Start/End: Complemental strand, 12014319 - 12014084
Alignment:
29 aaagcatagagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatattaggagta 128  Q
    ||||| || |||| ||||||| |||||| ||||||||||||||||| |||||| ||||| ||||||||||||||||||||| |||||||||||| |||||    
12014319 aaagcgtaaagaccattatgtgggtagaatgatgatcacatctcacggatcattgataaggagttatcaagtcttcacataaatataaatattaagagta 12014220  T
129 atatttatattggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgat-agtggtgtattccaccc 227  Q
    ||||| |||||||||||| ||| |||||||||  ||||||| | ||  | ||||||   ||| |||  |||||||||||||| ||||||||||| |||||    
12014219 atattaatattggattgacccggcatgagaatgttacatagaacaatatgtaaaaa---tcacaagtcattctcatagtgataagtggtgtatttcaccc 12014123  T
228 ttcgacctgaaaccactatgtaccctagatgttggagtc 266  Q
    ||| |||| ||| |||| ||||| |||||||| ||||||    
12014122 ttcaacctaaaatcactgtgtactctagatgtaggagtc 12014084  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #19
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 37 - 344
Target Start/End: Complemental strand, 20391541 - 20391239
Alignment:
37 gagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatattaggagtaatatttat 136  Q
    |||||||||||||| |||||||||||| | |||||||  | |||| ||||  ||| ||||||||||  |||||||||||||| |||||||||||||||||    
20391541 gagactattatgtatgtagactgatgaccgcatctcatgggtcatagatat-gagatatcaagtctatacatagatataaatgttaggagtaatatttat 20391443  T
137 attggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattccacccttcgacctg 236  Q
    |||||||||| ||    |||||||||||||||||||  ||||| |||  | |||||||||||||||| | ||||| |  ||||| || | ||| ||||||    
20391442 attggattgacccactgtgagaatactacatagtaa--gttatgaaattt-tcataagatattctcacaatgataataatgtataccgctcttagacctg 20391346  T
237 aaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggttgatgggtactccat 336  Q
    |||||||||||  | |||||||| ||| || ||||||||||  |||||| ||||||||| |||| ||||| || |||| |||||||||||||||||  ||    
20391345 aaaccactatgatctctagatgt-ggactcaagtgctttgttgccattctaacgttgtctgtaaaaggataacaataacgttggttgatgggtacttgat 20391247  T
337 gaatcatg 344  Q
    ||||||||    
20391246 gaatcatg 20391239  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #20
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 37 - 344
Target Start/End: Complemental strand, 20779947 - 20779645
Alignment:
37 gagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatattaggagtaatatttat 136  Q
    |||||||||||||| |||||||||||| | |||||||  | |||| ||||  ||| ||||||||||  ||||||||||||||||||||||||||||||||    
20779947 gagactattatgtatgtagactgatgaccgcatctcatgggtcatagatat-gagatatcaagtctatacatagatataaatattaggagtaatatttat 20779849  T
137 attggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattccacccttcgacctg 236  Q
    |||||||||| ||    |||||||||||||||||  |||||||  ||| |||||||||||||||||| | ||||| |  |||||  | | ||| ||||||    
20779848 attggattgacccactgtgagaatactacatagt--aagttat-gaaattgtcataagatattctcacaatgataataatgtatatcgctcttagacctg 20779752  T
237 aaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggttgatgggtactccat 336  Q
    |||||||||||  | ||||||| |||| || ||||||||||  |||||| ||||||||| |||| ||||| || |||| ||||||||||||| |||  ||    
20779751 aaaccactatgatctctagatg-tggactcaagtgctttgttgccattctaacgttgtctgtaaaaggataacaataacgttggttgatgggcacttgat 20779653  T
337 gaatcatg 344  Q
    ||||||||    
20779652 gaatcatg 20779645  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #21
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 37 - 344
Target Start/End: Complemental strand, 22670559 - 22670257
Alignment:
37 gagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatattaggagtaatatttat 136  Q
    |||||||||||||| |||||||||||| | |||||||  | |||| ||||  ||| ||||||||||  ||||||||||||||||||||||||||||||||    
22670559 gagactattatgtatgtagactgatgaccgcatctcatgggtcatagatat-gagatatcaagtctatacatagatataaatattaggagtaatatttat 22670461  T
137 attggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattccacccttcgacctg 236  Q
    |||||||||| ||    |||||||||||||||||  |||||||  ||| |||||||||||||||||| | ||||| |  |||||  | | ||| ||||||    
22670460 attggattgacccactgtgagaatactacatagt--aagttat-gaaattgtcataagatattctcacaatgataataatgtatatcgctcttagacctg 22670364  T
237 aaaccactatgtaccctagatgttggagtcgagtgctttgtcaccattcaaacgttgtccgtaacaggatgactataaagttggttgatgggtactccat 336  Q
    |||||||||||  | ||||||| |||| || ||||||||||  |||||| ||||||||| |||| ||||| || |||| ||||||||||||| |||  ||    
22670363 aaaccactatgatctctagatg-tggactcaagtgctttgttgccattctaacgttgtctgtaaaaggataacaataacgttggttgatgggcacttgat 22670265  T
337 gaatcatg 344  Q
    ||||||||    
22670264 gaatcatg 22670257  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #22
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 37 - 344
Target Start/End: Complemental strand, 42817291 - 42816989
Alignment:
37 gagactattatgtaggtagactgatgatcacatctcacagatcatggataaagagttatcaagtcttcacatagatataaatattaggagtaatatttat 136  Q
    |||||||||||||| |||||||||||| | |||||||  | |||| ||||  ||| ||||||||||  ||||||||||||||||||||||||||||||||    
42817291 gagactattatgtatgtagactgatgaccgcatctcatgggtcatagatat-gagatatcaagtctatacatagatataaatattaggagtaatatttat 42817193  T
137 attggattgatccgtcatgagaatactacatagtaaaagttataaaaagtgtcataagatattctcatagtgatagtggtgtattccacccttcgacctg 236  Q
    |||||||||| ||    |||||||||||||||||  |||||||  ||| |||||||||||||||||| | ||||| |  |||||  | | ||| ||||||    
42817192 attggattgacccactgtgagaatactacatagt--aagttat-gaaattgtcataagatattctcacaatgataataatgtatatcgctcttagacctg 42817096  T