View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0095_low_37 (Length: 370)

Name: NF0095_low_37
Description: NF0095
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0095_low_37
NF0095_low_37
[»] chr8 (2 HSPs)
chr8 (38-342)||(23233261-23233566)
chr8 (85-342)||(23238660-23238917)
[»] chr7 (5 HSPs)
chr7 (109-331)||(23123081-23123297)
chr7 (202-342)||(23123698-23123838)
chr7 (213-333)||(23653821-23653938)
chr7 (213-333)||(23659596-23659713)
chr7 (206-307)||(24301781-24301883)
[»] chr3 (2 HSPs)
chr3 (212-305)||(8443193-8443285)
chr3 (277-333)||(8443708-8443764)
[»] chr6 (1 HSPs)
chr6 (212-299)||(13824969-13825056)
[»] chr2 (1 HSPs)
chr2 (212-332)||(20503416-20503538)


Alignment Details
Target: chr8 (Bit Score: 244; Significance: 1e-135; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 38 - 342
Target Start/End: Complemental strand, 23233566 - 23233261
Alignment:
38 tgagatgaaagatttcctttaagattaacaaaagnnnnnnnttgaacgagcttaccattagaaaaggatacaacaagaaatagggaaactaaaatgatca 137  Q
    ||||||||||||||||||||||||||||||||||       |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||    
23233566 tgagatgaaagatttcctttaagattaacaaaagaaaaaaattgaacgaacttaccattagaaaaggatacaacaagaaatagggaaactaaaatgatca 23233467  T
138 tagtatnnnnnnncttgaacatttcagccatttttt-atctttgtgtgtaaaaaatatgaactcctttattactgtatatagtaaaatacctcatgatat 236  Q
    ||||||       ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||    
23233466 tagtataaaaaaacttgaacatttcagccatttttttatctttgtgtgtaaaaaatatgaactcctttattactttatatagtaaaatacctcatgatat 23233367  T
237 gtttatgtcaattaaataattattaataataatgttgttgcaagaattccttcattaaaattagaacaatttctaaatgtttcgaaagtacattgatata 336  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||    
23233366 gtttatgtcaattaaataattattaataataatgttgttgcaagaattcctttattaaaattagaacaatttctaaatgtttcgaaagtacattgatata 23233267  T
337 ttatgt 342  Q
    ||||||    
23233266 ttatgt 23233261  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 137; E-Value: 2e-71
Query Start/End: Original strand, 85 - 342
Target Start/End: Complemental strand, 23238917 - 23238660
Alignment:
85 gagcttaccattagaaaaggatacaacaagaaatagggaaactaaaatgatcatagtatnnnnnnncttgaacatttcagccattttttatctttgtgtg 184  Q
    ||||||||| || ||||||| ||||||||||||||||||||| |||||||||||| |||       |||||||||||||||||||||| | ||||||| |    
23238917 gagcttacccttggaaaaggttacaacaagaaatagggaaacaaaaatgatcataatataaaaaatcttgaacatttcagccatttttcacctttgtgcg 23238818  T
185 taaaaaatatgaactcctttattactgtatatagtaaaatacctcatgatatgtttatgtcaattaaataattattaataataatgttgttgcaagaatt 284  Q
    ||| |||||| ||||| ||||| ||  |||||||||||||||||||||||||||||||||||||||||||| | ||||| |||| ||| |||||||||||    
23238817 taacaaatataaactcatttatcacattatatagtaaaatacctcatgatatgtttatgtcaattaaataagttttaatcataaggttattgcaagaatt 23238718  T
285 ccttcattaaaattagaacaatttctaaatgtttcgaaagtacattgatatattatgt 342  Q
    ||||||||||||||||||||||| |||||||| |||||||| |||  |||||| ||||    
23238717 ccttcattaaaattagaacaattgctaaatgtatcgaaagtgcatcaatatatcatgt 23238660  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 61; Significance: 4e-26; HSPs: 5)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 109 - 331
Target Start/End: Original strand, 23123081 - 23123297
Alignment:
109 aacaagaaatagggaaactaaaatgatcatagtatnnnnnnncttgaacatttcagccattttttatctttgtgtgtaaaaaatatgaactcctttatta 208  Q
    ||||| |||||||||||| | |||||  |||||||       |||||| |||||||||||| || | ||||||||  || || ||| || | |||||| |    
23123081 aacaaaaaatagggaaacaagaatgactatagtataaaagaacttgaaaatttcagccattattcacctttgtgt--aacaagtataaatttctttatca 23123178  T
209 ctgtatatagtaaaatacctcatgatatgtttatgtcaattaaataattattaataataatgttgttgcaagaattccttcattaaaattagaacaattt 308  Q
    || || ||||||||| || |  ||||||||||| ||||||||||||||| ||| ||||||||||   |||||||||| |||||||||||||||||||||     
23123179 ctttaaatagtaaaaaac-tagtgatatgtttacgtcaattaaataatttttattaataatgtt---gcaagaattctttcattaaaattagaacaattg 23123274  T
309 ctaaatgtttcgaaagtacattg 331  Q
    |||||| ||| ||||||||||||    
23123275 ctaaatattttgaaagtacattg 23123297  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 202 - 342
Target Start/End: Original strand, 23123698 - 23123838
Alignment:
202 tttattactgtatatagtaaaatacctcatgatatgtttatgtcaattaaataattattaataataatgttgttgcaagaattccttcattaaaattaga 301  Q
    ||||| ||| |||| ||| ||| | ||||||||||| | | ||||||||||||||| |||||||| |||||||| ||| |||||||||| |  |||||||    
23123698 tttatcactttatagagtgaaaaatctcatgatatgctcacgtcaattaaataatttttaataattatgttgttccaataattccttcactgtaattaga 23123797  T
302 acaatttctaaatgtttcgaaagtacattgatatattatgt 342  Q
    | ||||  || ||| || ||||||||||||| |||| ||||    
23123798 aaaattgttagatgatttgaaagtacattgaaatatcatgt 23123838  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 213 - 333
Target Start/End: Complemental strand, 23653938 - 23653821
Alignment:
213 atatagtaaaatacctcatgatatgtttatgtcaattaaataattattaataataatgttgttgcaagaattccttcattaaaattagaacaatttctaa 312  Q
    |||||||||| ||  || || ||||||||| |||||||||||||| ||||| || ||||||||||||||  | ||   |||||||||||| ||||| |||    
23653938 atatagtaaattatatcttgttatgtttatatcaattaaataatttttaattattatgttgttgcaagatatact---ttaaaattagaataatttttaa 23653842  T
313 atgtttcgaaagtacattgat 333  Q
    |||| || |||| ||||||||    
23653841 atgtctctaaagaacattgat 23653821  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 213 - 333
Target Start/End: Complemental strand, 23659713 - 23659596
Alignment:
213 atatagtaaaatacctcatgatatgtttatgtcaattaaataattattaataataatgttgttgcaagaattccttcattaaaattagaacaatttctaa 312  Q
    |||||||||||  |||| || ||||||||  ||||||||||| ||  |  |||| ||||||||||||||| |||||   |||| |||||| ||||| |||    
23659713 atatagtaaaaatcctcttgttatgtttacatcaattaaatagtttattttaattatgttgttgcaagaaatcctt---taaagttagaataatttttaa 23659617  T
313 atgtttcgaaagtacattgat 333  Q
    ||||  | |||||||||||||    
23659616 atgtccctaaagtacattgat 23659596  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 206 - 307
Target Start/End: Complemental strand, 24301883 - 24301781
Alignment:
206 ttactgtatatagtaaaatacctcatgatatgtttatgtcaattaaataattattaataata--atgttgttgcaagaattccttcattaaaattagaac 303  Q
    ||||| |||||||| ||| | ||||||  | ||||||||||||||||| ||| |||||||||  |||||| | |||||| ||  |||||||||||||||     
24301883 ttactttatatagtgaaaaatctcatgcaaggtttatgtcaattaaat-atttttaataatagtatgttgctacaagaaatcaatcattaaaattagaat 24301785  T
304 aatt 307  Q
    ||||    
24301784 aatt 24301781  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 42; Significance: 0.000000000000009; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 212 - 305
Target Start/End: Complemental strand, 8443285 - 8443193
Alignment:
212 tatatagtaaaatacctcatgatatgtttatgtcaattaaataattattaataataatgttgttgcaagaattccttcattaaaattagaacaa 305  Q
    ||||||||||||| | |||||||||  || |||||||||||||||| | |||||||||||||||||||  ||| ||| | ||||||||||||||    
8443285 tatatagtaaaat-catcatgatatagttttgtcaattaaataattttcaataataatgttgttgcaattatttctttaataaaattagaacaa 8443193  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 277 - 333
Target Start/End: Complemental strand, 8443764 - 8443708
Alignment:
277 caagaattccttcattaaaattagaacaatttctaaatgtttcgaaagtacattgat 333  Q
    ||||||||||||||||||||||| ||||||| |||| | ||| ||||| ||||||||    
8443764 caagaattccttcattaaaattaaaacaattgctaagtattttgaaagcacattgat 8443708  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 32; Significance: 0.000000008; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 212 - 299
Target Start/End: Complemental strand, 13825056 - 13824969
Alignment:
212 tatatagtaaaatacctcatgatatgtttatgtcaattaaataattattaataataatgttgttgcaagaattccttcattaaaatta 299  Q
    |||||||||||| |  |||||  ||||||| |||||| ||||| ||| |||||||  |||| ||||||||| | ||||||||||||||    
13825056 tatatagtaaaaaagatcatgcaatgtttacgtcaataaaatatttaataataattttgttattgcaagaaattcttcattaaaatta 13824969  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 32; Significance: 0.000000008; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 212 - 332
Target Start/End: Complemental strand, 20503538 - 20503416
Alignment:
212 tatatagtaaaatacctcatgatatgtttatgtcaattaaataattatt--aataataatgttgttgcaagaattccttcattaaaattagaacaatttc 309  Q
    ||||||||| || ||| |||| ||| |||||||||||||||  ||| ||  |||||| |||| ||| ||| || ||||||||||||||||||| ||||      
20503538 tatatagtagaaaaccacatgctatttttatgtcaattaaaatatttttttaataattatgtagtttcaataaatccttcattaaaattagaaaaattat 20503439  T
310 taaatgtttcgaaagtacattga 332  Q
    ||||||  || |||||| |||||    
20503438 taaatggctctaaagtatattga 20503416  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 150967 times since January 2019
Visitors: 1524