View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0095_low_38 (Length: 352)

Name: NF0095_low_38
Description: NF0095
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0095_low_38
NF0095_low_38
[»] chr4 (1 HSPs)
chr4 (14-323)||(50200860-50201168)
[»] chr2 (2 HSPs)
chr2 (40-165)||(13342974-13343099)
chr2 (250-324)||(13342765-13342839)
[»] chr7 (1 HSPs)
chr7 (82-155)||(48892603-48892676)


Alignment Details
Target: chr4 (Bit Score: 266; Significance: 1e-148; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 266; E-Value: 1e-148
Query Start/End: Original strand, 14 - 323
Target Start/End: Original strand, 50200860 - 50201168
Alignment:
14 agagggcagaagaaccctacctgttaccaagaacagcatgcaatttgacaatgatttcttcctcctgaggagttatgttacctctcttcacatctgatct 113  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
50200860 agagggcagaagaaccctacctgttaccaagaacagcatgcaatttgacaatgatttcttcctcctgaggagttatgttacctctcttcacatctgatct 50200959  T
114 taagtagtttatccatctgagtctgcaactctttccacatctcaacaaacctaatatttcattttgtttnnnnnnnnnnnnaatactcagatcagacaca 213  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||             ||||||||||||||||||    
50200960 taagtagtttatccatctgagtctgcaactctttccacatctcaacaaacctaatatttcattttgtttatatatatatac-atactcagatcagacaca 50201058  T
214 ataacatatttaaatatcatcaaaatcattaatcatttacctgcattctttggcaaagatctccaagatccttcaccatgttcttggatataatcagtta 313  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
50201059 ataacatatttaaatatcatcaaaatcattaatcatttacctgcattctttggcaaagatctccaagatccttcaccatgttcttggatataatcagtta 50201158  T
314 agatcttatc 323  Q
    ||||||||||    
50201159 agatcttatc 50201168  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 70; Significance: 2e-31; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 40 - 165
Target Start/End: Complemental strand, 13343099 - 13342974
Alignment:
40 ccaagaacagcatgcaatttgacaatgatttcttcctcctgaggagttatgttacctctcttcacatctgatcttaagtagtttatccatctgagtctgc 139  Q
    ||||||||||||||||| |||||||||||||||||||| ||||| | |||||| |||||||||||||||| ||| || ||||| |||||||| ||||| |    
13343099 ccaagaacagcatgcaacttgacaatgatttcttcctcatgaggggatatgtttcctctcttcacatctgctctcaaatagttgatccatcttagtctac 13343000  T
140 aactctttccacatctcaacaaacct 165  Q
    ||||||| ||||| || |||||||||    
13342999 aactcttcccacaccttaacaaacct 13342974  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 250 - 324
Target Start/End: Complemental strand, 13342839 - 13342765
Alignment:
250 ttacctgcattctttggcaaagatctccaagatccttcaccatgttcttggatataatcagttaagatcttatct 324  Q
    |||||||| ||||| |||||| | ||||||||||||||||||| ||||| ||| |||||||| ||||| ||||||    
13342839 ttacctgctttcttaggcaaaaacctccaagatccttcaccattttctttgatgtaatcagtcaagattttatct 13342765  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 82 - 155
Target Start/End: Original strand, 48892603 - 48892676
Alignment:
82 ggagttatgttacctctcttcacatctgatcttaagtagtttatccatctgagtctgcaactctttccacatct 155  Q
    ||||||||||| |||||||| | ||||| |||||  ||||| |||||||| ||||||||||| |||||||||||    
48892603 ggagttatgtttcctctctttatatctggtcttagatagttcatccatcttagtctgcaactttttccacatct 48892676  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 149223 times since January 2019
Visitors: 1516