View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0095_low_39 (Length: 352)

Name: NF0095_low_39
Description: NF0095
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF0095_low_39
[»] chr4 (1 HSPs)
chr4 (11-323)||(50200857-50201168)
[»] chr2 (2 HSPs)
chr2 (40-165)||(13342974-13343099)
chr2 (250-324)||(13342765-13342839)
[»] chr7 (1 HSPs)
chr7 (82-155)||(48892603-48892676)

Alignment Details
Target: chr4 (Bit Score: 269; Significance: 1e-150; HSPs: 1)
Name: chr4

Target: chr4; HSP #1
Raw Score: 269; E-Value: 1e-150
Query Start/End: Original strand, 11 - 323
Target Start/End: Original strand, 50200857 - 50201168
11 cagagagggcagaagaaccctacctgttaccaagaacagcatgcaatttgacaatgatttcttcctcctgaggagttatgttacctctcttcacatctga 110  Q
50200857 cagagagggcagaagaaccctacctgttaccaagaacagcatgcaatttgacaatgatttcttcctcctgaggagttatgttacctctcttcacatctga 50200956  T
111 tcttaagtagtttatccatctgagtctgcaactctttccacatctcaacaaacctaatatttcattttgtttnnnnnnnnnnnnaatactcagatcagac 210  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||             |||||||||||||||    
50200957 tcttaagtagtttatccatctgagtctgcaactctttccacatctcaacaaacctaatatttcattttgtttatatatatatac-atactcagatcagac 50201055  T
211 acaataacatatttaaatatcatcaaaatcattaatcatttacctgcattctttggcaaagatctccaagatccttcaccatgttcttggatataatcag 310  Q
50201056 acaataacatatttaaatatcatcaaaatcattaatcatttacctgcattctttggcaaagatctccaagatccttcaccatgttcttggatataatcag 50201155  T
311 ttaagatcttatc 323  Q
50201156 ttaagatcttatc 50201168  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 70; Significance: 2e-31; HSPs: 2)
Name: chr2

Target: chr2; HSP #1
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 40 - 165
Target Start/End: Complemental strand, 13343099 - 13342974
40 ccaagaacagcatgcaatttgacaatgatttcttcctcctgaggagttatgttacctctcttcacatctgatcttaagtagtttatccatctgagtctgc 139  Q
    ||||||||||||||||| |||||||||||||||||||| ||||| | |||||| |||||||||||||||| ||| || ||||| |||||||| ||||| |    
13343099 ccaagaacagcatgcaacttgacaatgatttcttcctcatgaggggatatgtttcctctcttcacatctgctctcaaatagttgatccatcttagtctac 13343000  T
140 aactctttccacatctcaacaaacct 165  Q
    ||||||| ||||| || |||||||||    
13342999 aactcttcccacaccttaacaaacct 13342974  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 250 - 324
Target Start/End: Complemental strand, 13342839 - 13342765
250 ttacctgcattctttggcaaagatctccaagatccttcaccatgttcttggatataatcagttaagatcttatct 324  Q
    |||||||| ||||| |||||| | ||||||||||||||||||| ||||| ||| |||||||| ||||| ||||||    
13342839 ttacctgctttcttaggcaaaaacctccaagatccttcaccattttctttgatgtaatcagtcaagattttatct 13342765  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: chr7

Target: chr7; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 82 - 155
Target Start/End: Original strand, 48892603 - 48892676
82 ggagttatgttacctctcttcacatctgatcttaagtagtttatccatctgagtctgcaactctttccacatct 155  Q
    ||||||||||| |||||||| | ||||| |||||  ||||| |||||||| ||||||||||| |||||||||||    
48892603 ggagttatgtttcctctctttatatctggtcttagatagttcatccatcttagtctgcaactttttccacatct 48892676  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 149121 times since January 2019
Visitors: 1516