View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0095_low_4 (Length: 620)

Name: NF0095_low_4
Description: NF0095
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0095_low_4
NF0095_low_4
[»] chr8 (6 HSPs)
chr8 (36-483)||(36946836-36947283)
chr8 (538-612)||(36946681-36946755)
chr8 (31-90)||(5718451-5718510)
chr8 (33-85)||(5686299-5686351)
chr8 (33-90)||(25124417-25124474)
chr8 (33-86)||(38585096-38585149)
[»] chr4 (6 HSPs)
chr4 (35-93)||(24060625-24060683)
chr4 (33-90)||(42504198-42504255)
chr4 (36-84)||(5288572-5288620)
chr4 (49-88)||(16528629-16528668)
chr4 (43-123)||(2765331-2765419)
chr4 (33-90)||(30220747-30220803)
[»] scaffold0122 (1 HSPs)
scaffold0122 (31-93)||(18679-18741)
[»] chr1 (9 HSPs)
chr1 (33-90)||(21540121-21540178)
chr1 (33-90)||(43537149-43537206)
chr1 (35-90)||(10061641-10061696)
chr1 (46-93)||(26470004-26470051)
chr1 (36-110)||(23906591-23906664)
chr1 (36-86)||(35149672-35149722)
chr1 (36-83)||(33077737-33077784)
chr1 (44-90)||(29657422-29657468)
chr1 (44-84)||(4684526-4684566)
[»] chr7 (8 HSPs)
chr7 (42-90)||(44601056-44601104)
chr7 (33-90)||(21882773-21882830)
chr7 (33-90)||(46413747-46413804)
chr7 (31-84)||(46297658-46297711)
chr7 (46-90)||(20125650-20125694)
chr7 (33-88)||(1985053-1985108)
chr7 (34-84)||(8123739-8123789)
chr7 (31-87)||(22631525-22631581)
[»] chr2 (7 HSPs)
chr2 (33-88)||(14131203-14131258)
chr2 (34-89)||(37714471-37714526)
chr2 (31-84)||(3167941-3167994)
chr2 (33-86)||(27407469-27407522)
chr2 (34-90)||(38320204-38320260)
chr2 (33-88)||(20143015-20143070)
chr2 (49-113)||(5881413-5881476)
[»] chr6 (1 HSPs)
chr6 (31-88)||(6784708-6784765)
[»] chr5 (5 HSPs)
chr5 (44-87)||(7547323-7547366)
chr5 (36-90)||(3040264-3040318)
chr5 (35-84)||(20359962-20360011)
chr5 (33-93)||(30735322-30735382)
chr5 (36-90)||(30700874-30700928)
[»] chr3 (6 HSPs)
chr3 (33-90)||(1632855-1632912)
chr3 (33-85)||(18271972-18272024)
chr3 (44-90)||(2671961-2672007)
chr3 (44-90)||(34905904-34905950)
chr3 (41-87)||(45852941-45852987)
chr3 (33-90)||(26442996-26443053)
[»] scaffold0194 (1 HSPs)
scaffold0194 (33-90)||(27113-27170)


Alignment Details
Target: chr8 (Bit Score: 404; Significance: 0; HSPs: 6)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 404; E-Value: 0
Query Start/End: Original strand, 36 - 483
Target Start/End: Complemental strand, 36947283 - 36946836
Alignment:
36 aaatgaagggagataatgatgtgtaattaaagaaatgtgttagcaaatacactgtttttgatacattttgtcactgtatcaagcattttcctaagattta 135  Q
    |||||||||||| ||||||||| |||||||||||||||||||  |||||||||||||||||||||||||||||||||||||||||||| |||||||||||    
36947283 aaatgaagggaggtaatgatgtataattaaagaaatgtgttaataaatacactgtttttgatacattttgtcactgtatcaagcatttccctaagattta 36947184  T
136 attaagtgagataacagatttggccaatgtaattctaaccgaacctgtaaatcctccgacagcttgagattgatttgataaaaaacaatagaaaataaat 235  Q
    ||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||| |||||||||||    
36947183 attaagtgagataacagatttggccaaagtaattctaaccgaacctgtaaatcctcagacaacttgagattgatttgataaaaaacaaaagaaaataaat 36947084  T
236 tgacactagtagtaacgtaaacttcaacttatcaagagtgtcatgaagagggtcatttgagccacatgttgatcctagatgtcgatatcgacctagtata 335  Q
    |||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36947083 tgacaccagtagtaacgtaaacttcaacttatcaagagtgtcatcaagagggtcatttgagccacatgttgatcctagatgtcgatatcgacctagtata 36946984  T
336 accatcataatccagcaccacgacaatggtggtagctgatgccaaagtgccaacagtatccgatacgaaagtgataaaggccgatgttaaagccccactc 435  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36946983 accatcataatccagcaccacgacaatggtggtagctgatgccaaagtgccaacagtatccgatacgaaagtgataaaggccgatgttaaagccccactc 36946884  T
436 cactattctgtcttttttcattttaactcggtcaacataatgatgctc 483  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||    
36946883 cactattctgtcttttttcattttaactcggtcaacataatgatgctc 36946836  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 538 - 612
Target Start/End: Complemental strand, 36946755 - 36946681
Alignment:
538 taacaaaagaaaattcaattcataatcgtaagaaccaaattaacctttgttgaataacgctgagcaacagctagg 612  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||  |||||||||    
36946755 taacaaaagaaaattcaattcataatcgtaagaaccaaattaacctttgttgaataacgctgagttacagctagg 36946681  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 31 - 90
Target Start/End: Complemental strand, 5718510 - 5718451
Alignment:
31 gtcggaaatgaagggagataatgatgtgtaattaaagaaatgtgttagcaaatacactgt 90  Q
    ||||||||| |||| || ||||| ||||||||||| ||||||||||||||||||||||||    
5718510 gtcggaaatcaaggaaggtaatggtgtgtaattaaggaaatgtgttagcaaatacactgt 5718451  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 33 - 85
Target Start/End: Complemental strand, 5686351 - 5686299
Alignment:
33 cggaaatgaagggagataatgatgtgtaattaaagaaatgtgttagcaaatac 85  Q
    ||||||| ||||||| |||| || ||||||||| |||||||||||||||||||    
5686351 cggaaatcaagggaggtaataatatgtaattaatgaaatgtgttagcaaatac 5686299  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 33 - 90
Target Start/End: Original strand, 25124417 - 25124474
Alignment:
33 cggaaatgaagggagataatgatgtgtaattaaagaaatgtgttagcaaatacactgt 90  Q
    ||||||| ||| |||||||||||||||||||||  ||| || ||| ||||||||||||    
25124417 cggaaatcaagagagataatgatgtgtaattaagaaaaggtattaacaaatacactgt 25124474  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 33 - 86
Target Start/End: Complemental strand, 38585149 - 38585096
Alignment:
33 cggaaatgaagggagataatgatgtgtaattaaagaaatgtgttagcaaataca 86  Q
    ||||||| || |||| ||||  |||||||||||||||| |||||||||||||||    
38585149 cggaaatcaaaggaggtaattgtgtgtaattaaagaaaagtgttagcaaataca 38585096  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 47; Significance: 2e-17; HSPs: 6)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 35 - 93
Target Start/End: Original strand, 24060625 - 24060683
Alignment:
35 gaaatgaagggagataatgatgtgtaattaaagaaatgtgttagcaaatacactgtttt 93  Q
    ||||| ||||||||||||| ||||||||||| |||||||||||||||||||||||||||    
24060625 gaaatcaagggagataatggtgtgtaattaaggaaatgtgttagcaaatacactgtttt 24060683  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 33 - 90
Target Start/End: Complemental strand, 42504255 - 42504198
Alignment:
33 cggaaatgaagggagataatgatgtgtaattaaagaaatgtgttagcaaatacactgt 90  Q
    ||||||| ||||||| ||||||||||||||||| |||| |||||| ||||||||||||    
42504255 cggaaatcaagggaggtaatgatgtgtaattaaggaaaggtgttaacaaatacactgt 42504198  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 36 - 84
Target Start/End: Original strand, 5288572 - 5288620
Alignment:
36 aaatgaagggagataatgatgtgtaattaaagaaatgtgttagcaaata 84  Q
    |||| ||||||||||||| |||||||||||| |||||||||||||||||    
5288572 aaatcaagggagataatggtgtgtaattaaaaaaatgtgttagcaaata 5288620  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 49 - 88
Target Start/End: Original strand, 16528629 - 16528668
Alignment:
49 taatgatgtgtaattaaagaaatgtgttagcaaatacact 88  Q
    ||||| ||||||||||||||||||||||| ||||||||||    
16528629 taatggtgtgtaattaaagaaatgtgttaacaaatacact 16528668  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 43 - 123
Target Start/End: Complemental strand, 2765419 - 2765331
Alignment:
43 gggagataatgatgtgtaattaaagaaatgtgttagcaaa-tacactgt-------ttttgatacattttgtcactgtatcaagcattt 123  Q
    ||||||||||||||||||||||| |||| ||||||  ||| |||| |||       |||||||||||||||||||| ||||||||||||    
2765419 gggagataatgatgtgtaattaatgaaaggtgttaaaaaaatacagtgtcttgaatttttgatacattttgtcactatatcaagcattt 2765331  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 33 - 90
Target Start/End: Original strand, 30220747 - 30220803
Alignment:
33 cggaaatgaagggagataatgatgtgtaattaaagaaatgtgttagcaaatacactgt 90  Q
    ||||||| ||||||| || || ||||||||||| |||| |||||||||||||||||||    
30220747 cggaaatcaagggag-tattggtgtgtaattaaggaaaagtgttagcaaatacactgt 30220803  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0122 (Bit Score: 43; Significance: 0.000000000000004; HSPs: 1)
Name: scaffold0122
Description:

Target: scaffold0122; HSP #1
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 31 - 93
Target Start/End: Original strand, 18679 - 18741
Alignment:
31 gtcggaaatgaagggagataatgatgtgtaattaaagaaatgtgttagcaaatacactgtttt 93  Q
    |||| |||| ||||||||||||| || |||||||| |||||||||||||||||||||||||||    
18679 gtcgaaaattaagggagataatggtgagtaattaaggaaatgtgttagcaaatacactgtttt 18741  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 42; Significance: 0.00000000000002; HSPs: 9)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 33 - 90
Target Start/End: Original strand, 21540121 - 21540178
Alignment:
33 cggaaatgaagggagataatgatgtgtaattaaagaaatgtgttagcaaatacactgt 90  Q
    ||||||| |||||||||||||| ||||||||||||||| |||||| ||||||||||||    
21540121 cggaaattaagggagataatgaagtgtaattaaagaaaggtgttaacaaatacactgt 21540178  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 33 - 90
Target Start/End: Complemental strand, 43537206 - 43537149
Alignment:
33 cggaaatgaagggagataatgatgtgtaattaaagaaatgtgttagcaaatacactgt 90  Q
    ||||||| ||||||| ||||| ||||||||||||||||||||||| ||||||||||||    
43537206 cggaaatcaagggaggtaatggtgtgtaattaaagaaatgtgttaacaaatacactgt 43537149  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 35 - 90
Target Start/End: Original strand, 10061641 - 10061696
Alignment:
35 gaaatgaagggagataatgatgtgtaattaaagaaatgtgttagcaaatacactgt 90  Q
    ||||| ||||||| ||||||||||||||||| |||||||||||||||||| |||||    
10061641 gaaatcaagggaggtaatgatgtgtaattaaggaaatgtgttagcaaataaactgt 10061696  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 46 - 93
Target Start/End: Original strand, 26470004 - 26470051
Alignment:
46 agataatgatgtgtaattaaagaaatgtgttagcaaatacactgtttt 93  Q
    |||||||| ||||||||||| |||| ||||||||||||||||||||||    
26470004 agataatggtgtgtaattaaggaaaggtgttagcaaatacactgtttt 26470051  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 36 - 110
Target Start/End: Complemental strand, 23906664 - 23906591
Alignment:
36 aaatgaagggagataatgatgtgtaattaaagaaatgtgttagcaaatacactgtttttgatacattttgtcact 110  Q
    |||| ||| ||| ||||| |||||||||||||||| ||||||||||||||| || | |||||||| |||||||||    
23906664 aaatcaagagaggtaatggtgtgtaattaaagaaaggtgttagcaaatacattg-tcttgatacagtttgtcact 23906591  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 36 - 86
Target Start/End: Complemental strand, 35149722 - 35149672
Alignment:
36 aaatgaagggagataatgatgtgtaattaaagaaatgtgttagcaaataca 86  Q
    |||| ||||||||||||||||| ||||||| |||| |||||||||||||||    
35149722 aaatcaagggagataatgatgtataattaaggaaaggtgttagcaaataca 35149672  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 36 - 83
Target Start/End: Original strand, 33077737 - 33077784
Alignment:
36 aaatgaagggagataatgatgtgtaattaaagaaatgtgttagcaaat 83  Q
    |||| ||| ||| |||||||||||||||||| ||||||||||||||||    
33077737 aaatcaagagaggtaatgatgtgtaattaaataaatgtgttagcaaat 33077784  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 44 - 90
Target Start/End: Original strand, 29657422 - 29657468
Alignment:
44 ggagataatgatgtgtaattaaagaaatgtgttagcaaatacactgt 90  Q
    |||| ||||||| ||||||||| |||| |||||||||||||||||||    
29657422 ggaggtaatgatatgtaattaaggaaaggtgttagcaaatacactgt 29657468  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #9
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 44 - 84
Target Start/End: Original strand, 4684526 - 4684566
Alignment:
44 ggagataatgatgtgtaattaaagaaatgtgttagcaaata 84  Q
    |||||||||| ||||||||||| |||| |||||||||||||    
4684526 ggagataatggtgtgtaattaaggaaaggtgttagcaaata 4684566  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 41; Significance: 0.00000000000006; HSPs: 8)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 42 - 90
Target Start/End: Original strand, 44601056 - 44601104
Alignment:
42 agggagataatgatgtgtaattaaagaaatgtgttagcaaatacactgt 90  Q
    ||||||||||||||||||||||||  |||||||||||||||||||||||    
44601056 agggagataatgatgtgtaattaagaaaatgtgttagcaaatacactgt 44601104  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 33 - 90
Target Start/End: Complemental strand, 21882830 - 21882773
Alignment:
33 cggaaatgaagggagataatgatgtgtaattaaagaaatgtgttagcaaatacactgt 90  Q
    ||||||| ||||||| ||||| ||||||||||| |||| |||||||||||||||||||    
21882830 cggaaatcaagggaggtaatggtgtgtaattaaggaaaagtgttagcaaatacactgt 21882773  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 33 - 90
Target Start/End: Complemental strand, 46413804 - 46413747
Alignment:
33 cggaaatgaagggagataatgatgtgtaattaaagaaatgtgttagcaaatacactgt 90  Q
    ||||||| ||||||| ||||||||||||||||| |||| |||||| ||||||||||||    
46413804 cggaaatcaagggaggtaatgatgtgtaattaaggaaaggtgttaacaaatacactgt 46413747  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 31 - 84
Target Start/End: Original strand, 46297658 - 46297711
Alignment:
31 gtcggaaatgaagggagataatgatgtgtaattaaagaaatgtgttagcaaata 84  Q
    |||| |||| ||||||| ||||| ||||||||||| ||||||||||||||||||    
46297658 gtcgaaaatcaagggagttaatggtgtgtaattaaggaaatgtgttagcaaata 46297711  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 46 - 90
Target Start/End: Original strand, 20125650 - 20125694
Alignment:
46 agataatgatgtgtaattaaagaaatgtgttagcaaatacactgt 90  Q
    |||||||| |||||||||||||||| || ||||||||||||||||    
20125650 agataatggtgtgtaattaaagaaaggtattagcaaatacactgt 20125694  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 33 - 88
Target Start/End: Original strand, 1985053 - 1985108
Alignment:
33 cggaaatgaagggagataatgatgtgtaattaaagaaatgtgttagcaaatacact 88  Q
    ||||||| |||| || ||||| | ||||||||| ||||||||||||||||||||||    
1985053 cggaaatcaaggaaggtaatggtatgtaattaaggaaatgtgttagcaaatacact 1985108  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 34 - 84
Target Start/End: Original strand, 8123739 - 8123789
Alignment:
34 ggaaatgaagggagataatgatgtgtaattaaagaaatgtgttagcaaata 84  Q
    |||||| || ||||||||| |||| |||||||||||| |||||||||||||    
8123739 ggaaattaatggagataataatgtataattaaagaaaggtgttagcaaata 8123789  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #8
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 31 - 87
Target Start/End: Original strand, 22631525 - 22631581
Alignment:
31 gtcggaaatgaagggagataatgatgtgtaattaaagaaatgtgttagcaaatacac 87  Q
    ||||||||| || |||||||||  ||||||||||| |||| |||||||| |||||||    
22631525 gtcggaaatcaaaggagataatagtgtgtaattaaggaaaggtgttagctaatacac 22631581  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 40; Significance: 0.0000000000002; HSPs: 7)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 33 - 88
Target Start/End: Original strand, 14131203 - 14131258
Alignment:
33 cggaaatgaagggagataatgatgtgtaattaaagaaatgtgttagcaaatacact 88  Q
    ||||||| ||| ||||||||| ||||||||||| ||||||||||||||||||||||    
14131203 cggaaatcaagcgagataatggtgtgtaattaaggaaatgtgttagcaaatacact 14131258  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 34 - 89
Target Start/End: Original strand, 37714471 - 37714526
Alignment:
34 ggaaatgaagggagataatgatgtgtaattaaagaaatgtgttagcaaatacactg 89  Q
    |||||| || |||||||||| ||||||||||| |||| ||||||||||||||||||    
37714471 ggaaatcaaaggagataatggtgtgtaattaaggaaaggtgttagcaaatacactg 37714526  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 31 - 84
Target Start/End: Original strand, 3167941 - 3167994
Alignment:
31 gtcggaaatgaagggagataatgatgtgtaattaaagaaatgtgttagcaaata 84  Q
    ||||||||| || | || |||||||||||||||||||||| |||||||||||||    
3167941 gtcggaaatcaaagaaggtaatgatgtgtaattaaagaaaggtgttagcaaata 3167994  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 33 - 86
Target Start/End: Original strand, 27407469 - 27407522
Alignment:
33 cggaaatgaagggagataatgatgtgtaattaaagaaatgtgttagcaaataca 86  Q
    ||||||| |||| |||||||| ||||||||||| ||||||| ||||||||||||    
27407469 cggaaatcaaggaagataatgctgtgtaattaaggaaatgtattagcaaataca 27407522  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 34 - 90
Target Start/End: Complemental strand, 38320260 - 38320204
Alignment:
34 ggaaatgaagggagataatgatgtgtaattaaagaaatgtgttagcaaatacactgt 90  Q
    |||||| || |||| ||||||||||||| ||| ||||||||||| ||||||||||||    
38320260 ggaaatcaaaggaggtaatgatgtgtaaataaggaaatgtgttatcaaatacactgt 38320204  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 33 - 88
Target Start/End: Original strand, 20143015 - 20143070
Alignment:
33 cggaaatgaagggagataatgatgtgtaattaaagaaatgtgttagcaaatacact 88  Q
    ||||||| |||| || ||||||||||||||||| |||| ||||||| |||||||||    
20143015 cggaaatcaaggaaggtaatgatgtgtaattaaggaaaggtgttagaaaatacact 20143070  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 49 - 113
Target Start/End: Complemental strand, 5881476 - 5881413
Alignment:
49 taatgatgtgtaattaaagaaatgtgttagcaaatacactgtttttgatacattttgtcactgta 113  Q
    ||||||||||||||||| |||| || |||||||||| |||| | || ||||||||||||| ||||    
5881476 taatgatgtgtaattaaggaaaggtattagcaaatatactg-tattaatacattttgtcagtgta 5881413  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 38; Significance: 0.000000000004; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 31 - 88
Target Start/End: Complemental strand, 6784765 - 6784708
Alignment:
31 gtcggaaatgaagggagataatgatgtgtaattaaagaaatgtgttagcaaatacact 88  Q
    ||||||||| ||||||||||||| |||||||||||  ||| |||||||||||||||||    
6784765 gtcggaaatcaagggagataatggtgtgtaattaagaaaaggtgttagcaaatacact 6784708  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 36; Significance: 0.00000000006; HSPs: 5)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 44 - 87
Target Start/End: Original strand, 7547323 - 7547366
Alignment:
44 ggagataatgatgtgtaattaaagaaatgtgttagcaaatacac 87  Q
    |||||||||||| ||||||||| |||||||||||||||||||||    
7547323 ggagataatgatttgtaattaaggaaatgtgttagcaaatacac 7547366  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 36 - 90
Target Start/End: Complemental strand, 3040318 - 3040264
Alignment:
36 aaatgaagggagataatgatgtgtaattaaagaaatgtgttagcaaatacactgt 90  Q
    |||| ||||||| ||||| ||||||||||| |||| |||||||||||||||||||    
3040318 aaatcaagggaggtaatggtgtgtaattaaggaaaggtgttagcaaatacactgt 3040264  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 35 - 84
Target Start/End: Original strand, 20359962 - 20360011
Alignment:
35 gaaatgaagggagataatgatgtgtaattaaagaaatgtgttagcaaata 84  Q
    ||||| || |||||||||| |||||||||||||||| |||||||||||||    
20359962 gaaatcaaaggagataatggtgtgtaattaaagaaaggtgttagcaaata 20360011  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 33 - 93
Target Start/End: Complemental strand, 30735382 - 30735322
Alignment:
33 cggaaatgaagggagataatgatgtgtaattaaagaaatgtgttagcaaatacactgtttt 93  Q
    ||||||| ||||||| ||||| || ||||||||  ||| ||||||||||||||||||||||    
30735382 cggaaatcaagggaggtaatgctgggtaattaagaaaaagtgttagcaaatacactgtttt 30735322  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 36 - 90
Target Start/End: Complemental strand, 30700928 - 30700874
Alignment:
36 aaatgaagggagataatgatgtgtaattaaagaaatgtgttagcaaatacactgt 90  Q
    |||| ||||||| ||||| |||||||||||  ||| |||||||||||||||||||    
30700928 aaattaagggaggtaatgttgtgtaattaagaaaaggtgttagcaaatacactgt 30700874  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 34; Significance: 0.0000000009; HSPs: 6)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 33 - 90
Target Start/End: Original strand, 1632855 - 1632912
Alignment:
33 cggaaatgaagggagataatgatgtgtaattaaagaaatgtgttagcaaatacactgt 90  Q
    ||||||| || |||| ||||| |||||||||||||||| |||||| ||||||||||||    
1632855 cggaaatcaaaggaggtaatggtgtgtaattaaagaaacgtgttaacaaatacactgt 1632912  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 33 - 85
Target Start/End: Complemental strand, 18272024 - 18271972
Alignment:
33 cggaaatgaagggagataatgatgtgtaattaaagaaatgtgttagcaaatac 85  Q
    ||||||| || |||| ||||| |||||||||||||||| ||||||||||||||    
18272024 cggaaatcaatggaggtaatggtgtgtaattaaagaaaggtgttagcaaatac 18271972  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 44 - 90
Target Start/End: Original strand, 2671961 - 2672007
Alignment:
44 ggagataatgatgtgtaattaaagaaatgtgttagcaaatacactgt 90  Q
    |||||||||||||||||||||| ||||  ||||| ||||||||||||    
2671961 ggagataatgatgtgtaattaaggaaagatgttaacaaatacactgt 2672007  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 44 - 90
Target Start/End: Original strand, 34905904 - 34905950
Alignment:
44 ggagataatgatgtgtaattaaagaaatgtgttagcaaatacactgt 90  Q
    |||| ||||||||| ||||||| |||| |||||||||||||||||||    
34905904 ggaggtaatgatgtataattaaggaaaggtgttagcaaatacactgt 34905950  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 41 - 87
Target Start/End: Complemental strand, 45852987 - 45852941
Alignment:
41 aagggagataatgatgtgtaattaaagaaatgtgttagcaaatacac 87  Q
    ||||||||||||||| |||||||||  ||| ||||||||||||||||    
45852987 aagggagataatgatatgtaattaagaaaaggtgttagcaaatacac 45852941  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 33 - 90
Target Start/End: Original strand, 26442996 - 26443053
Alignment:
33 cggaaatgaagggagataatgatgtgtaattaaagaaatgtgttagcaaatacactgt 90  Q
    ||||||| ||||||| ||||| |||||||||||  ||| |||||| ||||||||||||    
26442996 cggaaatcaagggaggtaatggtgtgtaattaacaaaaggtgttaccaaatacactgt 26443053  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0194 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: scaffold0194
Description:

Target: scaffold0194; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 33 - 90
Target Start/End: Complemental strand, 27170 - 27113
Alignment:
33 cggaaatgaagggagataatgatgtgtaattaaagaaatgtgttagcaaatacactgt 90  Q
    ||||||| ||||||||||||   |||||||||| |||| |||||| ||||||||||||    
27170 cggaaatcaagggagataatagagtgtaattaaggaaaggtgttaacaaatacactgt 27113  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 125832 times since January 2019
Visitors: 1390