View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0095_low_40 (Length: 349)

Name: NF0095_low_40
Description: NF0095
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0095_low_40
NF0095_low_40
[»] chr5 (7 HSPs)
chr5 (10-261)||(38848772-38849024)
chr5 (10-261)||(39310505-39310756)
chr5 (10-261)||(38750078-38750329)
chr5 (13-261)||(38807406-38807655)
chr5 (13-236)||(38865761-38865985)
chr5 (162-207)||(22654244-22654289)
chr5 (162-207)||(37328209-37328254)
[»] chr7 (1 HSPs)
chr7 (118-200)||(31268165-31268247)
[»] scaffold0754 (1 HSPs)
scaffold0754 (163-216)||(3821-3875)
[»] scaffold0563 (2 HSPs)
scaffold0563 (163-216)||(671-725)
scaffold0563 (163-216)||(10353-10407)
[»] scaffold0543 (1 HSPs)
scaffold0543 (163-216)||(76-130)
[»] scaffold0492 (1 HSPs)
scaffold0492 (163-216)||(713-767)
[»] chr1 (4 HSPs)
chr1 (163-216)||(15830048-15830102)
chr1 (163-216)||(15831776-15831830)
chr1 (163-216)||(15833503-15833557)
chr1 (180-208)||(46627271-46627299)


Alignment Details
Target: chr5 (Bit Score: 165; Significance: 3e-88; HSPs: 7)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 165; E-Value: 3e-88
Query Start/End: Original strand, 10 - 261
Target Start/End: Original strand, 38848772 - 38849024
Alignment:
10 aaatgatggttcaatggactaggctcaccaggccatatgggctgagaatacagcagcatgtgatccctccattgtcaagagaaggaagtgttccctgctc 109  Q
    ||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||| ||||||||||||| ||||||||||||||||||||| ||||||    
38848772 aaatgatggttcaatgggctaggctcaccaggccatacgggctgagaatacagcagcctgtgatccctccactgtcaagagaaggaagtgttcactgctc 38848871  T
110 tatgaaaccaacctcatgcggatccctccattctaatgaccaggagacctgagccttcacccaaatcccatggcccaactctcaacttggagcgggca-g 208  Q
    | |||||||| ||||||||||||||||||||||||  |||||||||| ||| |||||| || | |||||||||||||||||||||||||||||||||| |    
38848872 tgtgaaaccagcctcatgcggatccctccattctagggaccaggagatctgtgccttcgccaagatcccatggcccaactctcaacttggagcgggcagg 38848971  T
209 ccagcatagtgtatcctacagtccaacctcttaagcatcaaccatgttccatc 261  Q
    ||||||||||||||||||||| ||||||| |||||   || ||||||||||||    
38848972 ccagcatagtgtatcctacagcccaacctgttaagacacagccatgttccatc 38849024  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 161; E-Value: 8e-86
Query Start/End: Original strand, 10 - 261
Target Start/End: Original strand, 39310505 - 39310756
Alignment:
10 aaatgatggttcaatggactaggctcaccaggccatatgggctgagaatacagcagcatgtgatccctccattgtcaagagaaggaagtgttccctgctc 109  Q
    ||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||| ||||||||||||| ||||||||||||||||||||| ||||||    
39310505 aaatgatggttcaatgg-ctaggctcaccaggccatatgggctgagaatactgcagcctgtgatccctccactgtcaagagaaggaagtgttcactgctc 39310603  T
110 tatgaaaccaacctcatgcggatccctccattctaatgaccaggagacctgagccttcacccaaatcccatggcccaactctcaacttggagcgggca-g 208  Q
    | |||||||| |||||||||||||||||| ||||| ||||||||||| |||||||||| ||||||||||||||||||||||||||||||||| ||||| |    
39310604 tgtgaaaccagcctcatgcggatccctccgttctagtgaccaggagatctgagccttcgcccaaatcccatggcccaactctcaacttggagtgggcagg 39310703  T
209 ccagcatagtgtatcctacagtccaacctcttaagcatcaaccatgttccatc 261  Q
    |||||||| |||| ||||||| ||||||| |||||   ||| |||||||||||    
39310704 ccagcataatgtaccctacagcccaacctgttaagacacaatcatgttccatc 39310756  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 157; E-Value: 2e-83
Query Start/End: Original strand, 10 - 261
Target Start/End: Complemental strand, 38750329 - 38750078
Alignment:
10 aaatgatggttcaatggactaggctcaccaggccatatgggctgagaatacagcagcatgtgatccctccattgtcaagagaaggaagtgttccctgctc 109  Q
    |||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||| ||||||||| |||||||||||||||||| || ||||||    
38750329 aaatgatggttcaatggactaggctcaccaggcc-tatgggctgagaatacagcagcctgtaatccctccactgtcaagagaaggaagtgatcactgctc 38750231  T
110 tatgaaaccaacctcatgcggatccctccattctaatgaccaggagacctgagccttcacccaaatcccatggcccaactctcaacttggagcgggca-g 208  Q
    | |||||||| |||||||||||||||||| ||||| ||||||||||| |||||||||| ||||||||||||||||||||||||||||||||| ||||| |    
38750230 tgtgaaaccagcctcatgcggatccctccgttctagtgaccaggagatctgagccttcgcccaaatcccatggcccaactctcaacttggagtgggcagg 38750131  T
209 ccagcatagtgtatcctacagtccaacctcttaagcatcaaccatgttccatc 261  Q
    |||||||| |||| ||||||| ||||||| |||||   || ||||||||||||    
38750130 ccagcataatgtaccctacagcccaacctgttaagacacagccatgttccatc 38750078  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 138; E-Value: 4e-72
Query Start/End: Original strand, 13 - 261
Target Start/End: Complemental strand, 38807655 - 38807406
Alignment:
13 tgatggttcaatggactaggctcaccaggccatatgggctgagaatacagcagcatgtgatccctccattgtcaagagaaggaagtgttccctgctctat 112  Q
    |||||||||||||| ||||||||||||||| |||||| | |||||| ||||||| ||| ||||||||| |||| |||||||||||||||| ||||||| |    
38807655 tgatggttcaatgggctaggctcaccaggctatatggaccgagaatgcagcagcctgtaatccctccactgtcgagagaaggaagtgttcactgctctgt 38807556  T
113 gaaaccaacctcatgcggatccctccattctaatgaccaggagacctgagccttcacccaaatcccatggcccaactctcaacttggagcgggc-agcca 211  Q
    ||||||| |||||||||| ||||||| |||||  ||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||| |||||    
38807555 gaaaccagcctcatgcggttccctccgttctagggaccaggagacctgagccttcgcccaaatcccatggcccaactctcaacttggagtgggcaagcca 38807456  T
212 gcatagtgtatcctacagtccaacctcttaagcatcaaccatgttccatc 261  Q
    || ||||||| ||||||| ||||||| |||||   || ||||||||||||    
38807455 gcttagtgtaccctacagcccaacctgttaagacacagccatgttccatc 38807406  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 137; E-Value: 2e-71
Query Start/End: Original strand, 13 - 236
Target Start/End: Original strand, 38865761 - 38865985
Alignment:
13 tgatggttcaatggactaggctcaccaggccatatgggctgagaatacagcagcatgtgatccctccattgtcaagagaaggaagtgttccctgctctat 112  Q
    |||||||||| ||  ||||||||||||||||||||  ||  ||||||| ||||| ||||||||||||| ||||||||||||||||||||| ||||||| |    
38865761 tgatggttcagtgtgctaggctcaccaggccatataagccaagaatactgcagcctgtgatccctccactgtcaagagaaggaagtgttcactgctctgt 38865860  T
113 gaaaccaacctcatgcggatccctccattctaatgaccaggagacctgagccttcacccaaatcccatggcccaactctcaacttggagcgggca-gcca 211  Q
     |||||| |||||||||||||||||||||||| ||||||||||| |||||||||| ||||||||||||||||||||||||||||||||| ||||| ||||    
38865861 aaaaccagcctcatgcggatccctccattctagtgaccaggagatctgagccttcgcccaaatcccatggcccaactctcaacttggagtgggcaggcca 38865960  T
212 gcatagtgtatcctacagtccaacc 236  Q
    |||||||||| ||||||| ||||||    
38865961 gcatagtgtaccctacagcccaacc 38865985  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 162 - 207
Target Start/End: Complemental strand, 22654289 - 22654244
Alignment:
162 gccttcacccaaatcccatggcccaactctcaacttggagcgggca 207  Q
    |||||| |||||||||| ||||||||||||||||||||||||||||    
22654289 gccttcgcccaaatcccgtggcccaactctcaacttggagcgggca 22654244  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 162 - 207
Target Start/End: Original strand, 37328209 - 37328254
Alignment:
162 gccttcacccaaatcccatggcccaactctcaacttggagcgggca 207  Q
    |||||| |||||||||| |||||||||||||||||||||| |||||    
37328209 gccttcgcccaaatcccgtggcccaactctcaacttggagagggca 37328254  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 39; Significance: 0.0000000000005; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 118 - 200
Target Start/End: Complemental strand, 31268247 - 31268165
Alignment:
118 caacctcatgcggatccctccattctaatgaccaggagacctgagccttcacccaaatcccatggcccaactctcaacttgga 200  Q
    ||||||||||| ||||||||||||||| ||| || ||||  || |||||| | ||||| |||| |||||||||||||||||||    
31268247 caacctcatgcagatccctccattctagtgatcatgagatttgggccttcgctcaaattccatagcccaactctcaacttgga 31268165  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0754 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: scaffold0754
Description:

Target: scaffold0754; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 163 - 216
Target Start/End: Complemental strand, 3875 - 3821
Alignment:
163 ccttcacccaaatcccatggcccaactctcaacttggagcgggca-gccagcata 216  Q
    ||||||||||  |||| |||| ||||||||||||||||||||||| |||||||||    
3875 ccttcacccatgtcccgtggcacaactctcaacttggagcgggcaggccagcata 3821  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0563 (Bit Score: 31; Significance: 0.00000003; HSPs: 2)
Name: scaffold0563
Description:

Target: scaffold0563; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 163 - 216
Target Start/End: Complemental strand, 725 - 671
Alignment:
163 ccttcacccaaatcccatggcccaactctcaacttggagcgggca-gccagcata 216  Q
    ||||||||||  |||| |||| ||||||||||||||||||||||| |||||||||    
725 ccttcacccatgtcccgtggcacaactctcaacttggagcgggcaggccagcata 671  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0563; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 163 - 216
Target Start/End: Complemental strand, 10407 - 10353
Alignment:
163 ccttcacccaaatcccatggcccaactctcaacttggagcgggca-gccagcata 216  Q
    ||||||||||  |||| |||| ||||||||||||||||||||||| |||||||||    
10407 ccttcacccatgtcccgtggcacaactctcaacttggagcgggcaggccagcata 10353  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0543 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: scaffold0543
Description:

Target: scaffold0543; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 163 - 216
Target Start/End: Original strand, 76 - 130
Alignment:
163 ccttcacccaaatcccatggcccaactctcaacttggagcgggca-gccagcata 216  Q
    ||||||||||  |||| |||| ||||||||||||||||||||||| |||||||||    
76 ccttcacccatgtcccgtggcacaactctcaacttggagcgggcaggccagcata 130  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0492 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: scaffold0492
Description:

Target: scaffold0492; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 163 - 216
Target Start/End: Complemental strand, 767 - 713
Alignment:
163 ccttcacccaaatcccatggcccaactctcaacttggagcgggca-gccagcata 216  Q
    ||||||||||  |||| |||| ||||||||||||||||||||||| |||||||||    
767 ccttcacccatgtcccgtggcacaactctcaacttggagcgggcaggccagcata 713  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 31; Significance: 0.00000003; HSPs: 4)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 163 - 216
Target Start/End: Original strand, 15830048 - 15830102
Alignment:
163 ccttcacccaaatcccatggcccaactctcaacttggagcgggca-gccagcata 216  Q
    ||||||||||  |||| |||| ||||||||||||||||||||||| |||||||||    
15830048 ccttcacccatgtcccgtggcacaactctcaacttggagcgggcaggccagcata 15830102  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 163 - 216
Target Start/End: Original strand, 15831776 - 15831830
Alignment:
163 ccttcacccaaatcccatggcccaactctcaacttggagcgggca-gccagcata 216  Q
    ||||||||||  |||| |||| ||||||||||||||||||||||| |||||||||    
15831776 ccttcacccatgtcccgtggcacaactctcaacttggagcgggcaggccagcata 15831830  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 163 - 216
Target Start/End: Original strand, 15833503 - 15833557
Alignment:
163 ccttcacccaaatcccatggcccaactctcaacttggagcgggca-gccagcata 216  Q
    ||||||||||  |||| |||| ||||||||||||||||||||||| |||||||||    
15833503 ccttcacccatgtcccgtggcacaactctcaacttggagcgggcaggccagcata 15833557  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 180 - 208
Target Start/End: Original strand, 46627271 - 46627299
Alignment:
180 tggcccaactctcaacttggagcgggcag 208  Q
    |||||||||||||||||||||||||||||    
46627271 tggcccaactctcaacttggagcgggcag 46627299  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 149312 times since January 2019
Visitors: 1516