View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0095_low_42 (Length: 335)

Name: NF0095_low_42
Description: NF0095
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0095_low_42
NF0095_low_42
[»] chr8 (2 HSPs)
chr8 (99-332)||(32990684-32990917)
chr8 (217-258)||(32982303-32982344)


Alignment Details
Target: chr8 (Bit Score: 222; Significance: 1e-122; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 99 - 332
Target Start/End: Original strand, 32990684 - 32990917
Alignment:
99 ggtggcctcactagcaagccaacaacagagcttcataggtggagttgcagttggcaacagaggataaagagcaagggcggtgattgcgagggtaaatggc 198  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |    
32990684 ggtggcctcactagcaagccaacaacagagcttcataggtggagttgcagttggcaacagaggataaagagcaagggcagtgattgcgagggtaaatgac 32990783  T
199 aattgagaattggcatcattgttctctacaatgctgcatctcttgggaagtccacaatgatagatttagtggaaacttgtgaattgggaagttgaggttt 298  Q
    ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32990784 aattgagaattggcatcattgttctctacgatgctgcatctcttgggaagtccacaatgatagatttagtggaaacttgtgaattgggaagttgaggttt 32990883  T
299 gaatagattcaccaaccttgaatcaacaagacta 332  Q
    ||||||||||||||||||||||||||||||||||    
32990884 gaatagattcaccaaccttgaatcaacaagacta 32990917  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 217 - 258
Target Start/End: Original strand, 32982303 - 32982344
Alignment:
217 ttgttctctacaatgctgcatctcttgggaagtccacaatga 258  Q
    ||||||||||| |||||||| |||||||||||||||| ||||    
32982303 ttgttctctaccatgctgcacctcttgggaagtccacgatga 32982344  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 126338 times since January 2019
Visitors: 1390