View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0095_low_43 (Length: 324)

Name: NF0095_low_43
Description: NF0095
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF0095_low_43
[»] chr7 (4 HSPs)
chr7 (82-218)||(8412329-8412464)
chr7 (89-224)||(8351042-8351179)
chr7 (87-136)||(8451736-8451785)
chr7 (102-163)||(8358843-8358903)

Alignment Details
Target: chr7 (Bit Score: 121; Significance: 6e-62; HSPs: 4)
Name: chr7

Target: chr7; HSP #1
Raw Score: 121; E-Value: 6e-62
Query Start/End: Original strand, 82 - 218
Target Start/End: Complemental strand, 8412464 - 8412329
82 cacaaactcacaataaacaaaaagtcccacatcgaaaactttcaacaatagagagtgtaagttgcctataaaagcaacgcatatatcgttgtggtgtatt 181  Q
    |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||    
8412464 cacaaactcacagtaaacaaaaagtcccacatcgaaaactttcaacaatagagagtgtaagttgcctataaaagcaacgcatatatcgttgtagtgtatt 8412365  T
182 acttctctaatgagatgataggtgcatcagaacttat 218  Q
    || ||||||||||||||||||||||||||||||||||    
8412364 ac-tctctaatgagatgataggtgcatcagaacttat 8412329  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 86; E-Value: 4e-41
Query Start/End: Original strand, 89 - 224
Target Start/End: Complemental strand, 8351179 - 8351042
89 tcacaataaacaaaaagtcccacatcgaaaactttcaacaatagagagtgtaagttgcctataaaagcaacgcat-atatcgttgtggtgtattacttct 187  Q
    |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||| |||||||||| ||||||| |||||    
8351179 tcacaatagacaaaaagtcccacatcgaaaactttcaacaatagagagtgtaagttgcctataaaaacagcgcatgatatcgttgtagtgtatttcttct 8351080  T
188 ctaatgagatgataggtgcatcag-aacttatcagcaa 224  Q
    |||||||| ||||||| | || || |||||||||||||    
8351079 ctaatgagttgataggcgaatgagaaacttatcagcaa 8351042  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 87 - 136
Target Start/End: Complemental strand, 8451785 - 8451736
87 actcacaataaacaaaaagtcccacatcgaaaactttcaacaatagagag 136  Q
    ||||||| || ||||||||||||||||| ||||||||||| |||||||||    
8451785 actcacagtagacaaaaagtcccacatcaaaaactttcaataatagagag 8451736  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 102 - 163
Target Start/End: Complemental strand, 8358903 - 8358843
102 aaagtcccacatcgaaaactttcaacaatagagagtgtaagttgcctataaaagcaacgcat 163  Q
    |||||||||||||||||| |||| |||||| | || |||||||| ||||||||||| |||||    
8358903 aaagtcccacatcgaaaa-tttctacaatataaagagtaagttggctataaaagcagcgcat 8358843  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 150675 times since January 2019
Visitors: 1522