View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0095_low_44 (Length: 324)

Name: NF0095_low_44
Description: NF0095
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0095_low_44
NF0095_low_44
[»] chr1 (2 HSPs)
chr1 (141-324)||(44285708-44285890)
chr1 (144-324)||(44070126-44070305)
[»] chr3 (1 HSPs)
chr3 (144-239)||(16443749-16443843)


Alignment Details
Target: chr1 (Bit Score: 124; Significance: 9e-64; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 124; E-Value: 9e-64
Query Start/End: Original strand, 141 - 324
Target Start/End: Complemental strand, 44285890 - 44285708
Alignment:
141 agaagctttagcactcaatctgtctctgttgctgcttcccggtaacattgatcaagaaatttacgggcggaaccttcctttaagtctatcgagtgcctga 240  Q
    ||||||||||| ||||||||  |||||||||||||||||||||||||||||||||  ||||||||| ||||| ||||||||||||| |||||||||||||    
44285890 agaagctttagtactcaatccatctctgttgctgcttcccggtaacattgatcaatcaatttacgg-cggaatcttcctttaagtcaatcgagtgcctga 44285792  T
241 cttctctattgatctgaccggctcgattgagacagagagtaaaggtgcgaatcggctaaaaggctgagtccgagactgggagaa 324  Q
    ||||||||||||||||||||  | |||||||||||||||||||||||||||||||||||||||  |||||||||| ||||||||    
44285791 cttctctattgatctgaccgaattgattgagacagagagtaaaggtgcgaatcggctaaaaggtcgagtccgagattgggagaa 44285708  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 113; E-Value: 3e-57
Query Start/End: Original strand, 144 - 324
Target Start/End: Original strand, 44070126 - 44070305
Alignment:
144 agctttagcactcaatctgtctctgttgctgcttcccggtaacattgatcaagaaatttacgggcggaaccttcctttaagtctatcgagtgcctgactt 243  Q
    |||||||| ||||||||||||||||||||||||||| || |||||  |||||  |||| |||| ||||||||||||||||||| ||| ||||||||||||    
44070126 agctttagtactcaatctgtctctgttgctgcttcctggcaacatcaatcaatcaattaacgg-cggaaccttcctttaagtcaatcaagtgcctgactt 44070224  T
244 ctctattgatctgaccggctcgattgagacagagagtaaaggtgcgaatcggctaaaaggctgagtccgagactgggagaa 324  Q
    |||||||||||||||||||| |||||||||||||||||||||||| || |||||||| |||||||||||||| ||||||||    
44070225 ctctattgatctgaccggctagattgagacagagagtaaaggtgcaaaccggctaaacggctgagtccgagattgggagaa 44070305  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 48; Significance: 2e-18; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 144 - 239
Target Start/End: Original strand, 16443749 - 16443843
Alignment:
144 agctttagcactcaatctgtctctgttgctgcttcccggtaacattgatcaagaaatttacgggcggaaccttcctttaagtctatcgagtgcctg 239  Q
    |||||||| ||||||||||||||||||||||||||| || |||||  |||||  |||| || ||||||||||||||||||||| ||| ||||||||    
16443749 agctttagtactcaatctgtctctgttgctgcttcctggcaacatcaatcaatcaattaac-ggcggaaccttcctttaagtcaatcaagtgcctg 16443843  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 150585 times since January 2019
Visitors: 1522