View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0095_low_48 (Length: 311)

Name: NF0095_low_48
Description: NF0095
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0095_low_48
NF0095_low_48
[»] chr8 (8 HSPs)
chr8 (7-177)||(6368060-6368239)
chr8 (7-163)||(19965146-19965312)
chr8 (7-163)||(21027684-21027850)
chr8 (243-276)||(6368365-6368398)
chr8 (117-163)||(19969225-19969271)
chr8 (117-163)||(21023538-21023584)
chr8 (117-163)||(44180395-44180441)
chr8 (117-163)||(44184740-44184786)
[»] chr7 (3 HSPs)
chr7 (7-163)||(29867680-29867846)
chr7 (7-82)||(626296-626370)
chr7 (117-163)||(29871907-29871953)
[»] chr1 (3 HSPs)
chr1 (7-163)||(20786503-20786669)
chr1 (7-163)||(29469392-29469558)
chr1 (117-163)||(20782357-20782403)
[»] chr5 (1 HSPs)
chr5 (7-82)||(28699205-28699280)


Alignment Details
Target: chr8 (Bit Score: 112; Significance: 1e-56; HSPs: 8)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 7 - 177
Target Start/End: Original strand, 6368060 - 6368239
Alignment:
7 tgtagggtgtttcagaatccatcagtttgatgaattaaggaatagtgtttaagcttttaaggtgggtttcactcac---------aagtccctccaagaa 97  Q
    |||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||| ||| | ||||||||||         |||||||||||||||    
6368060 tgtagggtgtttcagaatccatcagtttgatgaattgaggaataatgtttaagcttttacggtagctttcactcacttcactcgcaagtccctccaagaa 6368159  T
98 aaaggctgtgatagcaatctgttggtgattatacgtaactcatagaataagaagggaaaaactgaaatattattgaattg 177  Q
     |||||| ||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||    
6368160 gaaggctttgataccaatctgttggtgattatacgtaactcatagaataggaagggaaaaactgaaatattattgaattg 6368239  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 7 - 163
Target Start/End: Complemental strand, 19965312 - 19965146
Alignment:
7 tgtagggtgtttcagaatccatcagtttgatgaattaaggaatagtgtttaagcttttaaggtgggtttcactcac---------aagtccctccaagaa 97  Q
    |||||| |||||||||||||||| | |||||||| | |    ||||||||||||||||| ||||||||||||||||         ||||||||| |||||    
19965312 tgtaggatgtttcagaatccatctgattgatgaaatgaaaggtagtgtttaagcttttatggtgggtttcactcacttcactcacaagtccctctaagaa 19965213  T
98 aaaggctgt-gatagcaatctgttggtgattatacgtaactcatagaataagaagggaaaaactgaa 163  Q
     | |||| | |||| ||||||||||||| |||||||||||||||| |||| ||| ||||||||||||    
19965212 gatggctctagataccaatctgttggtgtttatacgtaactcataaaataggaaaggaaaaactgaa 19965146  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 7 - 163
Target Start/End: Original strand, 21027684 - 21027850
Alignment:
7 tgtagggtgtttcagaatccatcagtttgatgaattaaggaatagtgtttaagcttttaaggtgggtttcactcac---------aagtccctccaagaa 97  Q
    |||||| |||||||||||||||| | |||||||| | |    ||||||||||||||||| ||||||||||||||||         ||||||||| |||||    
21027684 tgtaggatgtttcagaatccatctgattgatgaaatgaaaggtagtgtttaagcttttatggtgggtttcactcacttcactcacaagtccctctaagaa 21027783  T
98 aaaggctgt-gatagcaatctgttggtgattatacgtaactcatagaataagaagggaaaaactgaa 163  Q
     | |||| | |||| ||||||||||||| |||||||||||||||| |||| ||| ||||||||||||    
21027784 gatggctctagataccaatctgttggtgtttatacgtaactcataaaataggaaaggaaaaactgaa 21027850  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 243 - 276
Target Start/End: Original strand, 6368365 - 6368398
Alignment:
243 tagagacttggtcaaatagtgcagctggaagtaa 276  Q
    ||||||||||||||||||||||||||||||||||    
6368365 tagagacttggtcaaatagtgcagctggaagtaa 6368398  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 117 - 163
Target Start/End: Complemental strand, 19969271 - 19969225
Alignment:
117 tgttggtgattatacgtaactcatagaataagaagggaaaaactgaa 163  Q
    |||||||| |||||||||||||||| |||| ||| ||||||||||||    
19969271 tgttggtgtttatacgtaactcataaaataggaaaggaaaaactgaa 19969225  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 117 - 163
Target Start/End: Original strand, 21023538 - 21023584
Alignment:
117 tgttggtgattatacgtaactcatagaataagaagggaaaaactgaa 163  Q
    |||||||| |||||||||||||||| |||| ||| ||||||||||||    
21023538 tgttggtgtttatacgtaactcataaaataggaaaggaaaaactgaa 21023584  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #7
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 117 - 163
Target Start/End: Complemental strand, 44180441 - 44180395
Alignment:
117 tgttggtgattatacgtaactcatagaataagaagggaaaaactgaa 163  Q
    |||||||| |||||||||||||||| |||| ||| ||||||||||||    
44180441 tgttggtgtttatacgtaactcataaaataggaaaggaaaaactgaa 44180395  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #8
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 117 - 163
Target Start/End: Complemental strand, 44184786 - 44184740
Alignment:
117 tgttggtgattatacgtaactcatagaataagaagggaaaaactgaa 163  Q
    |||||||| |||||||||||||||| |||| ||| ||||||||||||    
44184786 tgttggtgtttatacgtaactcataaaataggaaaggaaaaactgaa 44184740  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 55; Significance: 1e-22; HSPs: 3)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 7 - 163
Target Start/End: Complemental strand, 29867846 - 29867680
Alignment:
7 tgtagggtgtttcagaatccatcagtttgatgaattaaggaatagtgtttaagcttttaaggtgggtttcactcac---------aagtccctccaagaa 97  Q
    |||||| |||||||||||||||| | |||||||| | |    ||||||||||||||||| ||||||||||||||||         ||||||||| |||||    
29867846 tgtaggatgtttcagaatccatctgattgatgaaatgaaaggtagtgtttaagcttttatggtgggtttcactcacttcactcacaagtccctctaagaa 29867747  T
98 aaaggctgt-gatagcaatctgttggtgattatacgtaactcatagaataagaagggaaaaactgaa 163  Q
     |||||| | |||| ||||||||||||| |||||||||||||||| |||| ||| ||||||||||||    
29867746 gaaggctctagataccaatctgttggtgtttatacgtaactcataaaataggaaaggaaaaactgaa 29867680  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 7 - 82
Target Start/End: Complemental strand, 626370 - 626296
Alignment:
7 tgtagggtgtttcagaatccatcagtttgatgaattaaggaatagtgtttaagcttttaaggtgggtttcactcac 82  Q
    |||||| |||||||||||||||| | |||||||||| |  ||||||||||||||||||| ||||||||||||||||    
626370 tgtaggatgtttcagaatccatctgattgatgaattgaa-aatagtgtttaagcttttatggtgggtttcactcac 626296  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 117 - 163
Target Start/End: Complemental strand, 29871953 - 29871907
Alignment:
117 tgttggtgattatacgtaactcatagaataagaagggaaaaactgaa 163  Q
    |||||||| |||||||||||||||| |||| ||| ||||||||||||    
29871953 tgttggtgtttatacgtaactcataaaataggaaaggaaaaactgaa 29871907  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 55; Significance: 1e-22; HSPs: 3)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 7 - 163
Target Start/End: Original strand, 20786503 - 20786669
Alignment:
7 tgtagggtgtttcagaatccatcagtttgatgaattaaggaatagtgtttaagcttttaaggtgggtttcactcac---------aagtccctccaagaa 97  Q
    |||||| |||||||||||||||| | |||||||| | |    ||||||||||||||||| ||||||||||||||||         ||||||||| |||||    
20786503 tgtaggatgtttcagaatccatctgattgatgaaatgaaaggtagtgtttaagcttttatggtgggtttcactcacttcactcacaagtccctctaagaa 20786602  T
98 aaaggctgt-gatagcaatctgttggtgattatacgtaactcatagaataagaagggaaaaactgaa 163  Q
     |||||| | |||| ||||||||||||| |||||||||||||||| |||| ||| ||||||||||||    
20786603 gaaggctctagataccaatctgttggtgtttatacgtaactcataaaataggaaaggaaaaactgaa 20786669  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 7 - 163
Target Start/End: Complemental strand, 29469558 - 29469392
Alignment:
7 tgtagggtgtttcagaatccatcagtttgatgaattaaggaatagtgtttaagcttttaaggtgggtttcactcac---------aagtccctccaagaa 97  Q
    |||||| |||||||||||||||| | |||||||| | |    ||||||||||||||||| ||||||||||||||||         ||||||||| |||||    
29469558 tgtaggatgtttcagaatccatctgattgatgaaatgaaaggtagtgtttaagcttttatggtgggtttcactcacttcactcacaagtccctctaagaa 29469459  T
98 aaaggctgt-gatagcaatctgttggtgattatacgtaactcatagaataagaagggaaaaactgaa 163  Q
     || ||| | |||| ||||||||||||| |||||||||||||||| |||| ||| ||||||||||||    
29469458 gaaagctctagataccaatctgttggtgtttatacgtaactcataaaataggaaaggaaaaactgaa 29469392  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 117 - 163
Target Start/End: Original strand, 20782357 - 20782403
Alignment:
117 tgttggtgattatacgtaactcatagaataagaagggaaaaactgaa 163  Q
    |||||||| |||||||||||||||| |||| ||| ||||||||||||    
20782357 tgttggtgtttatacgtaactcataaaataggaaaggaaaaactgaa 20782403  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 7 - 82
Target Start/End: Original strand, 28699205 - 28699280
Alignment:
7 tgtagggtgtttcagaatccatcagtttgatgaattaaggaatagtgtttaagcttttaaggtgggtttcactcac 82  Q
    |||||| |||||||||||||||| | ||||| |||| |   |||||||||||||||||| ||||||||||||||||    
28699205 tgtaggatgtttcagaatccatctgattgataaattgaaagatagtgtttaagcttttatggtgggtttcactcac 28699280  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 150989 times since January 2019
Visitors: 1525