View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0095_low_49 (Length: 310)

Name: NF0095_low_49
Description: NF0095
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0095_low_49
NF0095_low_49
[»] chr6 (2 HSPs)
chr6 (42-286)||(31523776-31524020)
chr6 (18-51)||(31523709-31523742)
[»] chr8 (7 HSPs)
chr8 (122-218)||(15128381-15128477)
chr8 (140-218)||(5279577-5279655)
chr8 (140-222)||(5316437-5316519)
chr8 (148-241)||(14946588-14946681)
chr8 (140-207)||(5309804-5309871)
chr8 (140-222)||(5287309-5287391)
chr8 (40-77)||(35144595-35144632)
[»] chr4 (1 HSPs)
chr4 (42-78)||(19262985-19263021)


Alignment Details
Target: chr6 (Bit Score: 245; Significance: 1e-136; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 42 - 286
Target Start/End: Original strand, 31523776 - 31524020
Alignment:
42 gtgtcgtgtccggtgtctgtgtttgtgcttcatagatgattatatattttccttaacgttgaaagagtaacgttgcatgcatgcaacagattgttgccaa 141  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
31523776 gtgtcgtgtccggtgtctgtgtttgtgcttcatagatgattatatattttccttaacgttgaaagagtaacgttgcatgcatgcaacagattgttgccaa 31523875  T
142 agactaaccagaagagtccaagagacttggtagcctgctgattgtttccttgaggtgacatttctccaaagcctaaatataacaaacaaatctaatcaaa 241  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
31523876 agactaaccagaagagtccaagagacttggtagcctgctgattgtttccttgaggtgacatttctccaaagcctaaatataacaaacaaatctaatcaaa 31523975  T
242 attcaaatacattttgtatgtaggtacatatatttttctgtgatg 286  Q
    |||||||||||||||||||||||||||||||||||||||||||||    
31523976 attcaaatacattttgtatgtaggtacatatatttttctgtgatg 31524020  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 18 - 51
Target Start/End: Complemental strand, 31523742 - 31523709
Alignment:
18 ttaattaattgaatgtaatcacttgtgtcgtgtc 51  Q
    ||||||||||||||||||||||||||||||||||    
31523742 ttaattaattgaatgtaatcacttgtgtcgtgtc 31523709  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 65; Significance: 1e-28; HSPs: 7)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 122 - 218
Target Start/End: Complemental strand, 15128477 - 15128381
Alignment:
122 atgcaacagattgttgccaaagactaaccagaagagtccaagagacttggtagcctgctgattgtttccttgaggtgacatttctccaaagcctaaa 218  Q
    |||||| |||||||||||||||| | |||||||||||||||||||||||||||| |||||||||||||||| || ||||||||||| | ||||||||    
15128477 atgcaatagattgttgccaaagatttaccagaagagtccaagagacttggtagcttgctgattgtttccttaagctgacatttctctacagcctaaa 15128381  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 140 - 218
Target Start/End: Original strand, 5279577 - 5279655
Alignment:
140 aaagactaaccagaagagtccaagagacttggtagcctgctgattgtttccttgaggtgacatttctccaaagcctaaa 218  Q
    ||||||| |||||||||||||||||||||||||||| |||||||||||||||| || ||||||||||| | ||||||||    
5279577 aaagacttaccagaagagtccaagagacttggtagcttgctgattgtttccttaagctgacatttctctacagcctaaa 5279655  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 140 - 222
Target Start/End: Complemental strand, 5316519 - 5316437
Alignment:
140 aaagactaaccagaagagtccaagagacttggtagcctgctgattgtttccttgaggtgacatttctccaaagcctaaatata 222  Q
    ||||||| |||||||||||||||||||||||||||| |||||||||||||||| || |||||||| |  | ||||||||||||    
5316519 aaagacttaccagaagagtccaagagacttggtagcttgctgattgtttccttaagctgacatttttttacagcctaaatata 5316437  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 148 - 241
Target Start/End: Original strand, 14946588 - 14946681
Alignment:
148 accagaagagtccaagagacttggtagcctgctgattgtttccttgaggtgacatttctccaaagcctaaatataacaaacaaatctaatcaaa 241  Q
    |||||||||||||||||||||||||||| ||| |||||||||||| || ||||||||||| | |||||||| |||  || ||||| ||||||||    
14946588 accagaagagtccaagagacttggtagcttgcagattgtttccttaagctgacatttctctacagcctaaacatacaaatcaaatataatcaaa 14946681  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 140 - 207
Target Start/End: Complemental strand, 5309871 - 5309804
Alignment:
140 aaagactaaccagaagagtccaagagacttggtagcctgctgattgtttccttgaggtgacatttctc 207  Q
    ||||||| ||||||||||||||||||||||| |||| |||||||||||||||| || |||||||||||    
5309871 aaagacttaccagaagagtccaagagacttgatagcttgctgattgtttccttaagctgacatttctc 5309804  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 140 - 222
Target Start/End: Original strand, 5287309 - 5287391
Alignment:
140 aaagactaaccagaagagtccaagagacttggtagcctgctgattgtttccttgaggtgacatttctccaaagcctaaatata 222  Q
    ||||||| |||||||||||| |||||| |||||||| |||||||||||||||| || |||||||| || | ||||||||||||    
5287309 aaagacttaccagaagagtctaagagatttggtagcttgctgattgtttccttaagctgacatttttctacagcctaaatata 5287391  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #7
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 40 - 77
Target Start/End: Complemental strand, 35144632 - 35144595
Alignment:
40 ttgtgtcgtgtccggtgtctgtgtttgtgcttcataga 77  Q
    |||||||||||||||| ||| |||||||||||||||||    
35144632 ttgtgtcgtgtccggtctctatgtttgtgcttcataga 35144595  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 42 - 78
Target Start/End: Original strand, 19262985 - 19263021
Alignment:
42 gtgtcgtgtccggtgtctgtgtttgtgcttcatagat 78  Q
    ||||||||||||||||||||||| |||||||| ||||    
19262985 gtgtcgtgtccggtgtctgtgttcgtgcttcacagat 19263021  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 126431 times since January 2019
Visitors: 1390