View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0095_low_5 (Length: 590)

Name: NF0095_low_5
Description: NF0095
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0095_low_5
NF0095_low_5
[»] chr7 (2 HSPs)
chr7 (236-582)||(17294134-17294480)
chr7 (526-582)||(6612305-6612361)
[»] chr8 (11 HSPs)
chr8 (308-572)||(27712058-27712322)
chr8 (362-578)||(24508186-24508402)
chr8 (457-582)||(14726444-14726569)
chr8 (365-582)||(30647923-30648140)
chr8 (457-572)||(29551930-29552045)
chr8 (365-582)||(26088216-26088433)
chr8 (457-582)||(28865167-28865292)
chr8 (457-556)||(31040741-31040840)
chr8 (475-582)||(15329089-15329196)
chr8 (475-582)||(15509458-15509565)
chr8 (484-556)||(31075950-31076022)
[»] chr1 (1 HSPs)
chr1 (457-581)||(26087523-26087647)
[»] chr3 (1 HSPs)
chr3 (376-567)||(4818871-4819062)


Alignment Details
Target: chr7 (Bit Score: 303; Significance: 1e-170; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 303; E-Value: 1e-170
Query Start/End: Original strand, 236 - 582
Target Start/End: Complemental strand, 17294480 - 17294134
Alignment:
236 attttatattgtgcaaggtaggtatgatccaaaagaaactaagggacttgtgacttgcaataatagctggagatttttcatgcagaaaagttgcaacttc 335  Q
    |||||||||||||  ||||||||||||||||||||||||||| ||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||    
17294480 attttatattgtgagaggtaggtatgatccaaaagaaactaaaggaattgtgacttgcaataatagctagagatttttcatgcagaaaagttgcaacttc 17294381  T
336 aaacatgagcacaaccaatcttgataaactgaaagctgcggctgaagcgggtaatatagacatcctctatgcagtaattcaaattgattcgtccattcta 435  Q
    ||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||    
17294380 aaacatgagcacaaccaatcttgataaactgaaagttgcagctgaagcgggtaatatagacatcctttatgcagtaattcaaattgattcatccattcta 17294281  T
436 gagattatagattcgaatcagtttgttgaaactcctttgcatatcgccgcatctagggggcatgttcggtttgccattgaggttatgaatttgaaacctt 535  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||    
17294280 gagattatagattcgaatcagtttgttgaaactcctttgcatatcgccgcatctagggggcatcttcggtttgccatcgaggttatgaatttgaaacctt 17294181  T
536 catttgcttggaagctaaatccgcaaggattctgccccattcatctc 582  Q
    |||||||||||||||||||||||||||||||||||||||||||||||    
17294180 catttgcttggaagctaaatccgcaaggattctgccccattcatctc 17294134  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 526 - 582
Target Start/End: Complemental strand, 6612361 - 6612305
Alignment:
526 ttgaaaccttcatttgcttggaagctaaatccgcaaggattctgccccattcatctc 582  Q
    ||||||||||||||||||||||||||||| |||||||||||| ||||||| ||||||    
6612361 ttgaaaccttcatttgcttggaagctaaacccgcaaggattcagccccatccatctc 6612305  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 89; Significance: 1e-42; HSPs: 11)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 89; E-Value: 1e-42
Query Start/End: Original strand, 308 - 572
Target Start/End: Original strand, 27712058 - 27712322
Alignment:
308 atttttcatgcagaaaagttgcaacttcaaacatgagcacaaccaatcttgataaactgaaagctgcggctgaagcgggtaatatagacatcctctatgc 407  Q
    |||||||||||  || || ||||| |||||| |||| | ||||||||||| |||||||||||| ||| |||||||  ||||  |||||| |||||||||     
27712058 atttttcatgccaaagaggtgcaatttcaaaaatgaacccaaccaatcttcataaactgaaagttgcagctgaagacggtaggatagacctcctctatga 27712157  T
408 agtaattcaaattgattcgtccattctagagattatagattcgaatcagtttgttgaaactcctttgcatatcgccgcatctagggggcatgttcggttt 507  Q
    ||||||| |  ||||  | || ||| |||||| ||||||||| |  |||||||| ||||| ||||| || |||||||||| || ||| ||| | ||||||    
27712158 agtaattgaggttgacccatctattttagagaatatagattcaatacagtttgtcgaaacccctttacacatcgccgcatttaagggccatctccggttt 27712257  T
508 gccattgaggttatgaatttgaaaccttcatttgcttggaagctaaatccgcaaggattctgccc 572  Q
    ||||||||  ||||||||||||||||||| ||||||| |||||| ||||||||||||||| ||||    
27712258 gccattgaaattatgaatttgaaaccttcgtttgctttgaagcttaatccgcaaggattcagccc 27712322  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 73; E-Value: 5e-33
Query Start/End: Original strand, 362 - 578
Target Start/End: Original strand, 24508186 - 24508402
Alignment:
362 aactgaaagctgcggctgaagcgggtaatatagacatcctctatgcagtaattcaaattgattcgtccattctagagattatagattcgaatcagtttgt 461  Q
    ||||||| | ||| |||||||| ||| |||||| | ||||||||| |||||| ||| || |||| || ||| |||||||||||||||||||| |||||||    
24508186 aactgaatgttgcagctgaagcaggtgatataggcctcctctatggagtaatccaagttaattcatcgattttagagattatagattcgaatgagtttgt 24508285  T
462 tgaaactcctttgcatatcgccgcatctagggggcatgttcggtttgccattgaggttatgaatttgaaaccttcatttgcttggaagctaaatccgcaa 561  Q
      ||||||| || |||||||| ||| |  |||||||  | | |||||| ||||||||||||||||||||||| || ||||||| ||||||||||| | ||    
24508286 caaaactccattacatatcgcagcaacacgggggcacctcccgtttgcgattgaggttatgaatttgaaaccatcgtttgctttgaagctaaatcaggaa 24508385  T
562 ggattctgccccattca 578  Q
    ||| || |||| |||||    
24508386 ggactcagccctattca 24508402  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 66; E-Value: 7e-29
Query Start/End: Original strand, 457 - 582
Target Start/End: Original strand, 14726444 - 14726569
Alignment:
457 tttgttgaaactcctttgcatatcgccgcatctagggggcatgttcggtttgccattgaggttatgaatttgaaaccttcatttgcttggaagctaaatc 556  Q
    ||||||||||||||||| ||||  || ||||||| ||| ||| | |||||||||| ||| ||||||||||| |||||||||||||||||||||||| |||    
14726444 tttgttgaaactcctttacatactgctgcatctatgggtcatctccggtttgccactgaagttatgaatttaaaaccttcatttgcttggaagctagatc 14726543  T
557 cgcaaggattctgccccattcatctc 582  Q
     |||||||||| ||||||| ||||||    
14726544 tgcaaggattcagccccatccatctc 14726569  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 62; E-Value: 2e-26
Query Start/End: Original strand, 365 - 582
Target Start/End: Original strand, 30647923 - 30648140
Alignment:
365 tgaaagctgcggctgaagcgggtaatatagacatcctctatgcagtaattcaaattgattcgtccattctagagattatagattcgaatcagtttgttga 464  Q
    |||| ||||| |||||||| ||| |||||||  |||||||  |||||||||||  |||| | | |||| | |||  ||||||||| |  |  ||||||||    
30647923 tgaatgctgcagctgaagcaggtgatatagatctcctctacacagtaattcaagatgatccatacattttggagcatatagattcaataccatttgttga 30648022  T
465 aactcctttgcatatcgccgcatctagggggcatgttcggtttgccattgaggttatgaatttgaaaccttcatttgcttggaagctaaatccgcaagga 564  Q
    ||||||||| ||||| || ||||| | ||| ||| ||   |||||||||||  ||||||||||||||||||||||||||| |||| ||||||| ||||||    
30648023 aactcctttacatattgctgcatccatgggtcatattgactttgccattgaaattatgaatttgaaaccttcatttgctttgaagttaaatccacaagga 30648122  T
565 ttctgccccattcatctc 582  Q
    ||| ||||||| ||||||    
30648123 ttcagccccatccatctc 30648140  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 457 - 572
Target Start/End: Original strand, 29551930 - 29552045
Alignment:
457 tttgttgaaactcctttgcatatcgccgcatctagggggcatgttcggtttgccattgaggttatgaatttgaaaccttcatttgcttggaagctaaatc 556  Q
    ||||||||||||||||||||||||||||||| ||  || ||| |||  |||||||| |||||||||||||||||||||||||| ||||  |||||||||     
29551930 tttgttgaaactcctttgcatatcgccgcatttaacggtcatcttccttttgccatcgaggttatgaatttgaaaccttcattagctttcaagctaaata 29552029  T
557 cgcaaggattctgccc 572  Q
     |||||||||| ||||    
29552030 agcaaggattcagccc 29552045  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 55; E-Value: 3e-22
Query Start/End: Original strand, 365 - 582
Target Start/End: Original strand, 26088216 - 26088433
Alignment:
365 tgaaagctgcggctgaagcgggtaatatagacatcctctatgcagtaattcaaattgattcgtccattctagagattatagattcga-atcagtttgttg 463  Q
    |||||||||| ||| || | ||| |||||||  |||||||  |||||||||||  |||| | |||||| | |||| |||||||   | |||| |||||||    
26088216 tgaaagctgcagctcaaacaggtgatatagatctcctctactcagtaattcaagatgatccatccattttggagaatatagatgtaatatca-tttgttg 26088314  T
464 aaactcctttgcatatcgccgcatctagggggcatgttcggtttgccattgaggttatgaatttgaaaccttcatttgcttggaagctaaatccgcaagg 563  Q
    |||||||||| ||||| || ||||||  ||| ||| | | |||||||| |||  |||||||||| |||||||||||||| ||||||||||| ||||||||    
26088315 aaactcctttacatattgctgcatctttgggtcatatgccgtttgccaatgaaattatgaatttaaaaccttcatttgcatggaagctaaacccgcaagg 26088414  T
564 attctgccccattcatctc 582  Q
    |||| | ||||| ||||||    
26088415 attcagtcccatccatctc 26088433  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #7
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 457 - 582
Target Start/End: Original strand, 28865167 - 28865292
Alignment:
457 tttgttgaaactcctttgcatatcgccgcatctagggggcatgttcggtttgccattgaggttatgaatttgaaaccttcatttgcttggaagctaaatc 556  Q
    ||||||||||||||||| |||||||| ||||||| ||| ||  |||  ||||||| |||| ||||||  ||||||||||| ||||| |  ||||||||||    
28865167 tttgttgaaactcctttacatatcgctgcatctatgggtcaccttccttttgccactgagattatgacgttgaaaccttcgtttgccttaaagctaaatc 28865266  T
557 cgcaaggattctgccccattcatctc 582  Q
    ||||||||||| ||||||| ||||||    
28865267 cgcaaggattcagccccatccatctc 28865292  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #8
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 457 - 556
Target Start/End: Complemental strand, 31040840 - 31040741
Alignment:
457 tttgttgaaactcctttgcatatcgccgcatctagggggcatgttcggtttgccattgaggttatgaatttgaaaccttcatttgcttggaagctaaatc 556  Q
    ||||||||||||||| ||||||| || ||||||| ||| |||||||  ||||||| |||  ||||||  ||||||||||||||||| |||||||||||||    
31040840 tttgttgaaactcctctgcatatagctgcatctatgggacatgttcaatttgccactgaaattatgagattgaaaccttcatttgcatggaagctaaatc 31040741  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #9
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 475 - 582
Target Start/End: Original strand, 15329089 - 15329196
Alignment:
475 catatcgccgcatctagggggcatgttcggtttgccattgaggttatgaatttgaaaccttcatttgcttggaagctaaatccgcaaggattctgcccca 574  Q
    |||||||| ||||||| ||| ||  |||  ||||||| |||| ||||||  ||||||||||| |||||||  ||||||||||||||||||||| ||||||    
15329089 catatcgctgcatctatgggtcaccttcattttgccactgagattatgacgttgaaaccttcgtttgctttaaagctaaatccgcaaggattcagcccca 15329188  T
575 ttcatctc 582  Q
    | ||||||    
15329189 tccatctc 15329196  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #10
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 475 - 582
Target Start/End: Original strand, 15509458 - 15509565
Alignment:
475 catatcgccgcatctagggggcatgttcggtttgccattgaggttatgaatttgaaaccttcatttgcttggaagctaaatccgcaaggattctgcccca 574  Q
    |||||||| ||||||| ||| ||  |||  ||||||| |||| ||||||  ||||||||||| |||||||  ||||||||||||||||||||| ||||||    
15509458 catatcgctgcatctatgggtcaccttcattttgccactgagattatgacgttgaaaccttcgtttgctttaaagctaaatccgcaaggattcagcccca 15509557  T
575 ttcatctc 582  Q
    | ||||||    
15509558 tccatctc 15509565  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #11
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 484 - 556
Target Start/End: Complemental strand, 31076022 - 31075950
Alignment:
484 gcatctagggggcatgttcggtttgccattgaggttatgaatttgaaaccttcatttgcttggaagctaaatc 556  Q
    ||||||| ||| |||||||  ||||||| |||  ||||||  ||||||||||||||||||| |||||||||||    
31076022 gcatctatgggacatgttcaatttgccactgaaattatgagattgaaaccttcatttgctttgaagctaaatc 31075950  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 53; Significance: 4e-21; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 457 - 581
Target Start/End: Complemental strand, 26087647 - 26087523
Alignment:
457 tttgttgaaactcctttgcatatcgccgcatctagggggcatgttcggtttgccattgaggttatgaatttgaaaccttcatttgcttggaagctaaatc 556  Q
    ||||||||||||||||| ||||  || ||||||| ||| ||| |||  ||||||| |||  ||||||||||||||||||||| ||||||||| |||||||    
26087647 tttgttgaaactcctttacatacggctgcatctatgggtcatcttcaatttgccactgaaattatgaatttgaaaccttcatatgcttggaaactaaatc 26087548  T
557 cgcaaggattctgccccattcatct 581  Q
     |||||||||| | ||||| |||||    
26087547 agcaaggattcagtcccatccatct 26087523  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 48; Significance: 4e-18; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 376 - 567
Target Start/End: Original strand, 4818871 - 4819062
Alignment:
376 gctgaagcgggtaatatagacatcctctatgcagtaattcaaattgattcgtccattctagagattatagattcgaatcagtttgttgaaactcctttgc 475  Q
    |||||||| ||| |||||||  |||| ||| |||||||||||  |||| | | |||| | ||||| |||||||  |  |  |||||||||||||||||||    
4818871 gctgaagcaggtgatatagatctcctttatacagtaattcaagatgatccattcattttggagatgatagatttaataccatttgttgaaactcctttgc 4818970  T
476 atatcgccgcatctagggggcatgttcggtttgccattgaggttatgaatttgaaaccttcatttgcttggaagctaaatccgcaaggattc 567  Q
    |||| || ||||||| ||| ||| | |  ||||||   ||| ||||||| || ||||||||||||||||||||||||||||  |||||||||    
4818971 atattgctgcatctatgggtcatctccaatttgcctccgagattatgaagttaaaaccttcatttgcttggaagctaaatcaacaaggattc 4819062  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 150759 times since January 2019
Visitors: 1522