View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0095_low_50 (Length: 308)

Name: NF0095_low_50
Description: NF0095
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF0095_low_50
[»] chr5 (1 HSPs)
chr5 (1-225)||(38816155-38816379)

Alignment Details
Target: chr5 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr5

Target: chr5; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 1 - 225
Target Start/End: Complemental strand, 38816379 - 38816155
1 ttcttagggttttacattttgtctagattttgcagttggctactttttgtggttacagttggtatacatcacggccttatgtaaattaaactgactttgt 100  Q
38816379 ttcttagggttttacattttgtctagattttgcagttggctactttttgtggttacagttggtatacatcacggccttatgtaaattaaactgactttgt 38816280  T
101 ctgttagagaagggtatatagttgtatgaggtttctttgggtaggtgagaaattgaggttcaaaggatacaatataccttttcttgcattttctttcact 200  Q
38816279 ctgttagagaagggtatatagttgtatgaggtttctttgggtaggtgagaaattgaggttcaaaggatacaatataccttttcttgcattttctttcact 38816180  T
201 gagttatgataattgtgcatgtgat 225  Q
38816179 gagttatgataattgtgcatgtgat 38816155  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 151096 times since January 2019
Visitors: 1526