View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0095_low_51 (Length: 307)

Name: NF0095_low_51
Description: NF0095
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0095_low_51
NF0095_low_51
[»] chr2 (1 HSPs)
chr2 (32-300)||(9593404-9593672)


Alignment Details
Target: chr2 (Bit Score: 244; Significance: 1e-135; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 32 - 300
Target Start/End: Complemental strand, 9593672 - 9593404
Alignment:
32 ttctaggacagagaaagaggttaagtaagaaaaaaggcactttcatttcaacctataattacatgagtcattaaataggtctgttctgacatctggttta 131  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
9593672 ttctaggacagagaaagaggttaagtaagaaaaaaggcactttcatttcaacctataattacatgagtcattaaataggtctgttctgacatctggttta 9593573  T
132 gcatttaaggatttataaatgaaaagaaagnnnnnnntgtggttttttgagctcctttattgtatgtctaggaagaagtagtaatcagtttcttcatccc 231  Q
    ||||||||||||||||||||||||||||||       |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
9593572 gcatttaaggatttataaatgaaaagaaagaaaaaaatgtggttttttgagctcctttattgtatgtctaggaagaagtagtaatcagtttcttcatccc 9593473  T
232 tagaaagaaagtgtgattataggagtgtcttaatttctgtcaatttattatgccccatttcctttgttt 300  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||    
9593472 tagaaagaaagtgtgattataggagtgtcttaatttctgtcaatttattatgccccatttcttttgttt 9593404  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 151010 times since January 2019
Visitors: 1525