View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0095_low_52 (Length: 303)

Name: NF0095_low_52
Description: NF0095
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0095_low_52
NF0095_low_52
[»] chr7 (4 HSPs)
chr7 (61-197)||(8412329-8412464)
chr7 (68-203)||(8351042-8351179)
chr7 (66-115)||(8451736-8451785)
chr7 (81-142)||(8358843-8358903)


Alignment Details
Target: chr7 (Bit Score: 121; Significance: 5e-62; HSPs: 4)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 121; E-Value: 5e-62
Query Start/End: Original strand, 61 - 197
Target Start/End: Complemental strand, 8412464 - 8412329
Alignment:
61 cacaaactcacaataaacaaaaagtcccacatcgaaaactttcaacaatagagagtgtaagttgcctataaaagcaacgcatatatcgttgtggtgtatt 160  Q
    |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||    
8412464 cacaaactcacagtaaacaaaaagtcccacatcgaaaactttcaacaatagagagtgtaagttgcctataaaagcaacgcatatatcgttgtagtgtatt 8412365  T
161 acttctctaatgagatgataggtgcatcagaacttat 197  Q
    || ||||||||||||||||||||||||||||||||||    
8412364 ac-tctctaatgagatgataggtgcatcagaacttat 8412329  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 86; E-Value: 4e-41
Query Start/End: Original strand, 68 - 203
Target Start/End: Complemental strand, 8351179 - 8351042
Alignment:
68 tcacaataaacaaaaagtcccacatcgaaaactttcaacaatagagagtgtaagttgcctataaaagcaacgcat-atatcgttgtggtgtattacttct 166  Q
    |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||| |||||||||| ||||||| |||||    
8351179 tcacaatagacaaaaagtcccacatcgaaaactttcaacaatagagagtgtaagttgcctataaaaacagcgcatgatatcgttgtagtgtatttcttct 8351080  T
167 ctaatgagatgataggtgcatcag-aacttatcagcaa 203  Q
    |||||||| ||||||| | || || |||||||||||||    
8351079 ctaatgagttgataggcgaatgagaaacttatcagcaa 8351042  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 66 - 115
Target Start/End: Complemental strand, 8451785 - 8451736
Alignment:
66 actcacaataaacaaaaagtcccacatcgaaaactttcaacaatagagag 115  Q
    ||||||| || ||||||||||||||||| ||||||||||| |||||||||    
8451785 actcacagtagacaaaaagtcccacatcaaaaactttcaataatagagag 8451736  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 81 - 142
Target Start/End: Complemental strand, 8358903 - 8358843
Alignment:
81 aaagtcccacatcgaaaactttcaacaatagagagtgtaagttgcctataaaagcaacgcat 142  Q
    |||||||||||||||||| |||| |||||| | || |||||||| ||||||||||| |||||    
8358903 aaagtcccacatcgaaaa-tttctacaatataaagagtaagttggctataaaagcagcgcat 8358843  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 126449 times since January 2019
Visitors: 1390