View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0095_low_54 (Length: 296)

Name: NF0095_low_54
Description: NF0095
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0095_low_54
NF0095_low_54
[»] chr4 (4 HSPs)
chr4 (20-240)||(1495013-1495234)
chr4 (20-227)||(1516584-1516798)
chr4 (20-186)||(1533137-1533289)
chr4 (139-221)||(48780120-48780202)
[»] chr8 (2 HSPs)
chr8 (139-225)||(12729166-12729253)
chr8 (143-225)||(28696338-28696421)
[»] chr5 (2 HSPs)
chr5 (143-225)||(36202895-36202978)
chr5 (138-227)||(29006244-29006336)
[»] chr3 (2 HSPs)
chr3 (143-221)||(50914667-50914746)
chr3 (139-206)||(33709598-33709667)
[»] chr7 (1 HSPs)
chr7 (142-225)||(12239877-12239961)


Alignment Details
Target: chr4 (Bit Score: 198; Significance: 1e-108; HSPs: 4)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 20 - 240
Target Start/End: Complemental strand, 1495234 - 1495013
Alignment:
20 atgagattgaattctgtcactgctaaataatt-cttctaccagcgatgatctgaaattgaagtgaatcttatttatatatatttcacgttaataggactt 118  Q
    ||||||||||||||||| |||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1495234 atgagattgaattctgtgactgataaataatttcttctaccagcgatgatctgaaattgaagtgaatcttatttatatatatttcacgttaataggactt 1495135  T
119 gacactttttcggtattacattggaaagttgcaatggttaaaagagaccatttagagaaaaggtgtaaagctttacggttgaagcaatataaccattcat 218  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||    
1495134 gacactttttcggtattacattggaaagttgcaatggttaaaagagaccatttagagaaaaggtgtaaagctttacagttgaagcaatataaccattcat 1495035  T
219 gaacaaaattctttcacaggtt 240  Q
    |||||||||||||||| |||||    
1495034 gaacaaaattctttcaaaggtt 1495013  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 113; E-Value: 3e-57
Query Start/End: Original strand, 20 - 227
Target Start/End: Complemental strand, 1516798 - 1516584
Alignment:
20 atgagattgaattctgtcactgctaaataattcttctaccagcgatgatctgaaattgaagtgaatcttatttatatatatttcacgttaataggacttg 119  Q
    ||||||||||| |||| |||||||||||| ||||||||||||||||| |||||||||||||| ||||||||| |||||||||||| ||||||||||| ||    
1516798 atgagattgaagtctgccactgctaaatatttcttctaccagcgatggtctgaaattgaagtaaatcttattaatatatatttcaagttaataggacatg 1516699  T
120 acactttttcggt-------attacattggaaagttgcaatggttaaaagagaccatttagagaaaaggtgtaaagctttacggttgaagcaatataacc 212  Q
    |||||||||| ||       ||||||||||||| ||||||||||||||||||||  |||||||||||||||||  ||||||    ||| |||||||||||    
1516698 acactttttctgtattttggattacattggaaaattgcaatggttaaaagagacattttagagaaaaggtgtagtgctttagaaatgacgcaatataacc 1516599  T
213 attcatgaacaaaat 227  Q
    |||||||||||||||    
1516598 attcatgaacaaaat 1516584  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 20 - 186
Target Start/End: Complemental strand, 1533289 - 1533137
Alignment:
20 atgagattgaattctgtcactgctaaataattcttctaccagcgatgatctgaaattgaagtgaatcttatttatatatatttcacgttaataggacttg 119  Q
    ||||||||||| |||| |||||||||||| ||||||||||||||||| ||| ||||||||||||||||||||||||||||||||| |||||             
1533289 atgagattgaagtctgccactgctaaatatttcttctaccagcgatggtctaaaattgaagtgaatcttatttatatatatttcaagttaa--------- 1533199  T
120 acactttttcggtattacattggaaagttgcaatggttaaaagagaccatttagagaaaaggtgtaa 186  Q
      | ||||   | |||||||||||||||||||||||||||||||||||  |||||||||||||||||    
1533198 --agtttt---ggattacattggaaagttgcaatggttaaaagagacctattagagaaaaggtgtaa 1533137  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 139 - 221
Target Start/End: Complemental strand, 48780202 - 48780120
Alignment:
139 ttggaaagttgcaatggttaaaagagaccatttagagaaaaggtgtaaagctttacggttgaagcaatataaccattcatgaa 221  Q
    |||||||||||||||| |||||  ||| | |||||||||||||| ||| | || ||  ||||||||||||||| |||||||||    
48780202 ttggaaagttgcaatgattaaacaagatcttttagagaaaaggtataatgtttgacaattgaagcaatataactattcatgaa 48780120  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 52; Significance: 8e-21; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 139 - 225
Target Start/End: Original strand, 12729166 - 12729253
Alignment:
139 ttggaaagttgcaatggttaaa-agagaccatttagagaaaaggtgtaaagctttacggttgaagcaatataaccattcatgaacaaa 225  Q
    |||||||||||||||||||||| ||||||| |||||||||||||||||| |||  ||  |||||||||||||||||||||||| ||||    
12729166 ttggaaagttgcaatggttaaatagagaccttttagagaaaaggtgtaatgctcgacaattgaagcaatataaccattcatgagcaaa 12729253  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 143 - 225
Target Start/End: Complemental strand, 28696421 - 28696338
Alignment:
143 aaagttgcaatggttaaa-agagaccatttagagaaaaggtgtaaagctttacggttgaagcaatataaccattcatgaacaaa 225  Q
    ||||||||||||| |||| ||||| | ||||||||||| |||||| |||| ||  |||||||||| ||||||||||||||||||    
28696421 aaagttgcaatgggtaaatagagatcttttagagaaaatgtgtaatgcttaacaattgaagcaatgtaaccattcatgaacaaa 28696338  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 48; Significance: 2e-18; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 143 - 225
Target Start/End: Original strand, 36202895 - 36202978
Alignment:
143 aaagttgcaatggttaaaa-gagaccatttagagaaaaggtgtaaagctttacggttgaagcaatataaccattcatgaacaaa 225  Q
    ||||||||||||||||||| |||||| |||||||||||||||||| |||| ||  ||||| |||| ||||||||||||||||||    
36202895 aaagttgcaatggttaaaaagagaccttttagagaaaaggtgtaatgcttgacaattgaatcaatgtaaccattcatgaacaaa 36202978  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 138 - 227
Target Start/End: Original strand, 29006244 - 29006336
Alignment:
138 attggaaagttgcaatggttaaaagagaccatttagagaaaag---gtgtaaagctttacggttgaagcaatataaccattcatgaacaaaat 227  Q
    |||| |||||||||||  |||||||||| | |||||| ||||    |||||| | |||||| |||||||||| ||||||||||||||||||||    
29006244 attgaaaagttgcaataattaaaagagatcttttagaaaaaaaaaagtgtaatgttttacgattgaagcaatgtaaccattcatgaacaaaat 29006336  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 143 - 221
Target Start/End: Complemental strand, 50914746 - 50914667
Alignment:
143 aaagttgcaatggttaaa-agagaccatttagagaaaaggtgtaaagctttacggttgaagcaatataaccattcatgaa 221  Q
    |||||||||||||||||| ||||||| ||||||| |||||||||| |||| ||  ||||||||||  |||||||||||||    
50914746 aaagttgcaatggttaaatagagaccttttagagtaaaggtgtaatgcttgacaattgaagcaatgcaaccattcatgaa 50914667  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 139 - 206
Target Start/End: Original strand, 33709598 - 33709667
Alignment:
139 ttggaaagttgcaatggttaaaagagaccatt--tagagaaaaggtgtaaagctttacggttgaagcaat 206  Q
    ||||||||||||||||||||||||||||| ||  || | ||||||||||| |||||||  ||||||||||    
33709598 ttggaaagttgcaatggttaaaagagaccttttataaaaaaaaggtgtaatgctttacaattgaagcaat 33709667  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 142 - 225
Target Start/End: Complemental strand, 12239961 - 12239877
Alignment:
142 gaaagttgcaatggttaaa-agagaccatttagagaaaaggtgtaaagctttacggttgaagcaatataaccattcatgaacaaa 225  Q
    ||||||||||||||||||| | ||||| ||||| ||||| |||||  |||| ||  |||| ||||| ||||||||||||||||||    
12239961 gaaagttgcaatggttaaagaaagaccttttagtgaaaaagtgtattgcttgacaattgatgcaatgtaaccattcatgaacaaa 12239877  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 126167 times since January 2019
Visitors: 1390