View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0095_low_55 (Length: 292)

Name: NF0095_low_55
Description: NF0095
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0095_low_55
NF0095_low_55
[»] chr3 (1 HSPs)
chr3 (45-287)||(49472634-49472877)


Alignment Details
Target: chr3 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 45 - 287
Target Start/End: Original strand, 49472634 - 49472877
Alignment:
45 gatcaaatggcaaaatagagggaaacaatgttaatgtttctaaggtacgagaacccc-ccgacaccgacttggttcatcgatttatcttttgttatttga 143  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
49472634 gatcaaatggcaaaatagagggaaacaatgttaatgtttctaaggtacgagaacccccccgacaccgacttggttcatcgatttatcttttgttatttga 49472733  T
144 atgcctcatgtattttgaaattattattattgtaggaagaggaaattgaaatcgttgatgaaacggagaaatctaggacaaaaaaggatcttgtcaagaa 243  Q
    ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
49472734 atgcctcatgtattttgaaattattattattgtaggaagtggaaattgaaatcgttgatgaaacggagaaatctaggacaaaaaaggatcttgtcaagaa 49472833  T
244 taagaattcaaaattgccaagtcctagaggtcttcgtatgactt 287  Q
    ||| ||||||||||||||||||||||||||||||||||||||||    
49472834 taacaattcaaaattgccaagtcctagaggtcttcgtatgactt 49472877  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 150608 times since January 2019
Visitors: 1522