View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0095_low_56 (Length: 290)

Name: NF0095_low_56
Description: NF0095
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0095_low_56
NF0095_low_56
[»] chr4 (1 HSPs)
chr4 (15-290)||(50742263-50742541)


Alignment Details
Target: chr4 (Bit Score: 257; Significance: 1e-143; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 257; E-Value: 1e-143
Query Start/End: Original strand, 15 - 290
Target Start/End: Original strand, 50742263 - 50742541
Alignment:
15 tatgccaagcagttacattaggaatgtgttct---tcttcttctccttcctgtccatctacttccatgtatttctcaaatcctctgatcatggcctccat 111  Q
    ||||||||||||||||||||||||||||||||   ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||    
50742263 tatgccaagcagttacattaggaatgtgttcttcttcttcttctccttcctgtccatctacttccatgtacttctcaaatcctctgatcatggcctccat 50742362  T
112 agctaccttaagagacttcttgttacccttaagccctcgttgtgcagatgatacggcttgttgagacccaccatcagcagtggcagagcccatcaaagca 211  Q
    |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
50742363 agctaccttaagagactttttgttacccttaagccctcgttgtgcagatgatacggcttgttgagacccaccatcagcagtggcagagcccatcaaagca 50742462  T
212 tctactttctgctcagcaccggcaacactctcttgttcagcaaactgaatccaagcatcatcaagcctgtcttcaacat 290  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
50742463 tctactttctgctcagcaccggcaacactctcttgttcagcaaactgaatccaagcatcatcaagcctgtcttcaacat 50742541  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 126728 times since January 2019
Visitors: 1391