View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0095_low_57 (Length: 285)

Name: NF0095_low_57
Description: NF0095
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0095_low_57
NF0095_low_57
[»] chr7 (1 HSPs)
chr7 (89-285)||(41140255-41140451)


Alignment Details
Target: chr7 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 89 - 285
Target Start/End: Complemental strand, 41140451 - 41140255
Alignment:
89 gctttttgattagctgagtcatgctaataagcaaccaattatgtgtttatgttcctcgtcagctcccatgtcttggttcccaaatgcttgcgtggagtgg 188  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41140451 gctttttgattagctgagtcatgctaataagcaaccaattatgtgtttatgttcctcgtcagctcccatgtcttggttcccaaatgcttgcgtggagtgg 41140352  T
189 ggctataaatccatgcccattcaactaaacccacttatttttaattttataacaatatttaccatttcttttttggatcacattaaaaccaaaatac 285  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||    
41140351 ggctataaatccatgcccattcaactaaacccacttatttttaattttataacaatatttaccatttcttttttggatcccattaaaaccaaaatac 41140255  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 151215 times since January 2019
Visitors: 1526