View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0095_low_58 (Length: 279)

Name: NF0095_low_58
Description: NF0095
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0095_low_58
NF0095_low_58
[»] chr3 (1 HSPs)
chr3 (39-230)||(32605257-32605448)


Alignment Details
Target: chr3 (Bit Score: 176; Significance: 7e-95; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 176; E-Value: 7e-95
Query Start/End: Original strand, 39 - 230
Target Start/End: Original strand, 32605257 - 32605448
Alignment:
39 gcacagacggcacaccatagtaaatttggtgatctcactggcatcacatgatggaaatgaaatgttaatctgcaaattataccgaatacaactcaatgac 138  Q
    |||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||    
32605257 gcactgacggcacaccatagtaaatttgatgatctcactggcatcacatgatggaaatgaaatgttaatttgcaaattataccgaatacaactcaatgac 32605356  T
139 taatccattttcattgtatagtgtggataaaggtacacaattttctaatcacaaaaaacaactgattatctaagtgtttgcatgtacaccat 230  Q
    ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32605357 taatccattttcattgtgtagtgtggataaaggtacacaattttctaatcacaaaaaacaactgattatctaagtgtttgcatgtacaccat 32605448  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 126597 times since January 2019
Visitors: 1391