View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0095_low_59 (Length: 279)

Name: NF0095_low_59
Description: NF0095
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0095_low_59
NF0095_low_59
[»] chr8 (4 HSPs)
chr8 (146-211)||(20874528-20874592)
chr8 (54-101)||(20874480-20874527)
chr8 (147-246)||(20311205-20311305)
chr8 (147-246)||(21104842-21104942)
[»] chr1 (2 HSPs)
chr1 (147-205)||(30497471-30497529)
chr1 (149-185)||(11104875-11104911)
[»] chr7 (1 HSPs)
chr7 (177-245)||(5290753-5290821)
[»] chr4 (1 HSPs)
chr4 (147-238)||(13977908-13977999)
[»] chr5 (1 HSPs)
chr5 (147-246)||(19903035-19903133)


Alignment Details
Target: chr8 (Bit Score: 46; Significance: 3e-17; HSPs: 4)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 146 - 211
Target Start/End: Original strand, 20874528 - 20874592
Alignment:
146 ggtgtgtttgagcatttgtaatcttagtaactatagtgaacatcccttggaagtgaaagggaacta 211  Q
    |||||||||||||||||||||||||||| ||||||||||||||| |||||||  ||||||||||||    
20874528 ggtgtgtttgagcatttgtaatcttagt-actatagtgaacatctcttggaaacgaaagggaacta 20874592  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 54 - 101
Target Start/End: Original strand, 20874480 - 20874527
Alignment:
54 tgatgaggagactttgacagtcctgcgggaatggattcaacatgagcc 101  Q
    ||||||||||||||| ||||| ||||||||||||||||||||||||||    
20874480 tgatgaggagactttcacagttctgcgggaatggattcaacatgagcc 20874527  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 147 - 246
Target Start/End: Complemental strand, 20311305 - 20311205
Alignment:
147 gtgtgtttgagcatttgtaatc-ttagtaactatagtgaacatcccttggaagtgaaagggaactatactattctcgatttgggagaggaactggtataa 245  Q
    ||||||||| |||||||||||| ||| | | ||||||||| || | ||| ||||| ||||| ||||||||| ||||||||||  || |||||| ||||||    
20311305 gtgtgtttgggcatttgtaatctttaatgattatagtgaaaattcattgaaagtgcaaggggactatactactctcgatttgtaaggggaactagtataa 20311206  T
246 a 246  Q
    |    
20311205 a 20311205  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 147 - 246
Target Start/End: Complemental strand, 21104942 - 21104842
Alignment:
147 gtgtgtttgagcatttgtaatc-ttagtaactatagtgaacatcccttggaagtgaaagggaactatactattctcgatttgggagaggaactggtataa 245  Q
    ||||||||| |||||||||||| ||| | | ||||||||| || | ||| ||||| ||||| ||||||||| ||||||||||  || |||||| ||||||    
21104942 gtgtgtttgggcatttgtaatctttaatgattatagtgaaaattcattgaaagtgcaaggggactatactactctcgatttgtaaggggaactagtataa 21104843  T
246 a 246  Q
    |    
21104842 a 21104842  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 35; Significance: 0.0000000001; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 147 - 205
Target Start/End: Complemental strand, 30497529 - 30497471
Alignment:
147 gtgtgtttgagcatttgtaatcttagtaactatagtgaacatcccttggaagtgaaagg 205  Q
    ||||| ||||||||||||||||||  ||| ||||||||| ||| |||||||||||||||    
30497529 gtgtgcttgagcatttgtaatctttttaattatagtgaaaatctcttggaagtgaaagg 30497471  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 149 - 185
Target Start/End: Complemental strand, 11104911 - 11104875
Alignment:
149 gtgtttgagcatttgtaatcttagtaactatagtgaa 185  Q
    |||||||| |||||||||||||||||| |||||||||    
11104911 gtgtttgaacatttgtaatcttagtaattatagtgaa 11104875  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 177 - 245
Target Start/End: Original strand, 5290753 - 5290821
Alignment:
177 tatagtgaacatcccttggaagtgaaagggaactatactattctcgatttgggagaggaactggtataa 245  Q
    ||||||||||||||||| |||||| ||||| |||  |||| |||||||||| | |||||||| ||||||    
5290753 tatagtgaacatcccttagaagtgcaaggggactggactactctcgatttgtgggaggaactagtataa 5290821  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 147 - 238
Target Start/End: Original strand, 13977908 - 13977999
Alignment:
147 gtgtgtttgagcatttgtaatc-ttagtaactatagtgaacatcccttggaagtgaaagggaactatactattctcgatttgggagaggaact 238  Q
    ||||| |||||||||||||||| ||||| | ||||||||| || |||| |||||| ||||| |||| |||| ||||| |||| ||||||||||    
13977908 gtgtgcttgagcatttgtaatctttagtgattatagtgaaaattcctt-gaagtgcaaggggactagactactctcggtttgtgagaggaact 13977999  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 147 - 246
Target Start/End: Complemental strand, 19903133 - 19903035
Alignment:
147 gtgtgtttgagcatttgtaatcttagtaactatagtgaacatcccttggaagtgaaagggaactatactattctcgatttgggagaggaactggtataaa 246  Q
    ||||| |||||||||||||||||||||   |||| |||| |||| || ||||||  |||| |||| |||| ||||| |||| |||||||||| |||||||    
19903133 gtgtgcttgagcatttgtaatcttagtgtttatattgaaaatccttttgaagtgccaggg-actagactactctcggtttgtgagaggaactagtataaa 19903035  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 149570 times since January 2019
Visitors: 1516